abclinuxu.cz AbcLinuxu.cz itbiz.cz ITBiz.cz HDmag.cz HDmag.cz abcprace.cz AbcPráce.cz
AbcLinuxu hledá autory!
Inzerujte na AbcPráce.cz od 950 Kč
Rozšířené hledání
×
včera 19:33 | Zajímavý článek

Jozef Mlich se v příspěvku PinePhone je nové OpenMoko na svém blogu věnuje svému novému linuxovému chytrému telefonu PinePhone v edici BraveHeart: "Momentálně se pocity z tohohle zařízení dají přirovnat k BrokenMoku. Většina věcí prostě nefunguje. Minimálně ne sama od sebe. Začít se dá už u samotného hardware, kde existuje wiki stránka popisující nedostatky".

Ladislav Hagara | Komentářů: 4
včera 10:00 | Zajímavý projekt

Justine Haupt aktualizovala svůj open source mobilní telefon s rotační číselnicí a zveřejnila kompletní dokumentaci, vlastní kód, schémata i STL soubory pro 3D tisk. Desku plošných spojů případně i vytištěný obal lze koupit v jejím obchodu.

Ladislav Hagara | Komentářů: 28
včera 06:00 | IT novinky

Otevřená certifikační autorita Let's Encrypt v příspěvku na svém blogu informuje, že žádosti o vystavení certifikátů nově validuje z několika míst současně (Multi-Perspective Validation). Další informace v diskusním fóru.

Ladislav Hagara | Komentářů: 7
19.2. 13:55 | Nová verze

Byla vydána verze 15.0 na Debianu založené linuxové distribuce Untangle NG Firewall. Přehled novinek v poznámkách k vydání a ve videu na YouTube. Vyzkoušet lze (zatím neaktualizované) demo webového rozhraní.

Ladislav Hagara | Komentářů: 0
19.2. 12:11 | Pozvánky

Letošní ročník konference LinuxDays se uskuteční o víkendu 3. a 4. října, opět se potkáme v pražských Dejvicích na FIT ČVUT. Také během devátého ročníku nás budou čekat desítky přednášek, workshopy, stánky a spousta doprovodného programu. Aktuální dění můžete sledovat na Twitteru nebo Facebooku, přidat se můžete také do telegramové diskusní skupiny.

Petr Krčmář | Komentářů: 5
19.2. 10:22 | Zajímavý článek

Alexander Popov se v příspěvku na svém blogu podrobně věnuje možnostem zneužití bezpečnostní chyby CVE-2019-18683 v linuxovém podsystému V4L2. Videoukázka eskalace práv na YouTube. Chyba byla v upstreamu opravena v listopadu loňského roku. Alexander Popov se chybě věnoval ve své přednášce (pdf) na konferenci OffensiveCon 2020.

Ladislav Hagara | Komentářů: 0
19.2. 06:00 | Nová verze

Byla vydána nová verze 20.02.17 svobodného multiplatformního video editoru Shotcut (Wikipedie). Přehled novinek v oznámení o vydání. Využíván je MLT Multimedia Framework 6.20.0 a WebVfx 1.2.0. Nejnovější Shotcut je k dispozici také ve formátech AppImage, Flatpak i Snap.

Ladislav Hagara | Komentářů: 2
18.2. 16:22 | IT novinky

Spolkový úřad pro informační bezpečnost (Bundesamt für Sicherheit in der Informationstechnik) schválil používání softwarů Gpg4win a Gpg4KDE, tj. nadstaveb nad GnuPG, pro šifrování a přenos utajovaných informací stupně utajení Vyhrazené (VS-NUR FÜR DEN DIENSTGEBRAUCH (VS-NfD)), EU RESTRICTED a NATO RESTRICTED [reddit].

Ladislav Hagara | Komentářů: 0
18.2. 12:44 | Humor

Viceprezident společnosti Oracle Matthew O'Keefe napsal na Twitteru: "Kdyby databáze Oracle neexistovala, světová ekonomika by se zastavila. Kdyby většina open source distribuovaných databází neexistovala, byl by svět pro data mnohem bezpečnějším místem". Příspěvek rozpoutal diskusi nejenom na redditu a následně byl z Twitteru smazán (Wayback Machine).

Ladislav Hagara | Komentářů: 17
18.2. 09:33 | Nová verze

Byla vydána nová verze 1.38 správce síťových připojení ConnMan (Wikipedie). Z novinek lze zdůraznit podporu WireGuardu.

Ladislav Hagara | Komentářů: 0
Vydržela vám novoroční předsevzetí?
 (10%)
 (6%)
 (3%)
 (82%)
Celkem 168 hlasů
 Komentářů: 0
Rozcestník
Aktuální zápisy

www.AutoDoc.Cz

Štítky: není přiřazen žádný štítek

Evoluce?

27.7.2006 00:50 | Přečteno: 3134× | poslední úprava: 27.7.2006 00:56

Ano, tušíte správně, chystám se zcela vědomě a plánovitě přilít olej do ohně zdejších filozofických diskusí o křesťanství a podobných věcech.

Dostal jsem se k dokumentu Jak se nezbláznit (1,8MB PDF) od Pavla Kábrta s podtitulem "33 nebetyčných omylů rozšířených dnes mezi lidmi". Je to kniha křesťanského vědce, ve které se autor kromě čistě filozofických věcí opírá velmi silně a rozsáhle do darwinismu, evoluční teorie či Darwina jako člověka. Byl bych docela rád, kdyby si ji zájemci - a to hlavně z řad fundamentalistických evolucionistů - přečetli, tedy alespoň ty kapitoly, které se té věci týkají. Dopředu upozorňuju, že je toho dost. Přesto že jsem křesťan, nejsem kreacionista-extremista. V podstatě v těch věcech nemám uplně jisto...míra obraznosti prvních knih Bible, věrohodnost jistých principů vyskytujících se v evoluční teorii...hledám. O čem jsem ale přesvědčen je, že darwinismus a evoluční teorie má obrovské mezery, často úmyslně kryté s logikou typu "stvoření je implicitně nesmysl, takže pravdu prostě mít musíme, takže se to nějak vymyslí".

Dopředu bych rád poprosil evolucionistické fanatiky odmítající dialog (je vás mezi vědci naštěstí čím dál méně, víte to?), kteří by mě tady rádi uráželi nebo provozovali nějaký trolltalk, aby se ovládli a diskuse se zdrželi. Primárně mě zajímají názory lidií, kteří si z uvedeného dokumentu přečtou části o (ne)evoluci.

       

Hodnocení: 58 %

        špatnédobré        

Anketa

Jaký je váš názor na stvoření a vývoj světa?
 (45 %)
 (20 %)
 (9 %)
 (14 %)
 (9 %)
 (3 %)
Celkem 135 hlasů

Tiskni Sdílej: Linkuj Jaggni to Vybrali.sme.sk Google Del.icio.us Facebook

Komentáře

Vložit další komentář

vencour avatar 27.7.2006 00:54 vencour | skóre: 56 | blog: Tady je Vencourovo | Praha+západní Čechy
Rozbalit Rozbalit vše Re: Evoluce?

Autore, prosím, oprav odkaz. Děkuji.

A tento svět nechaly stvořit myši, ty pandimenzionální stvoření.

Ty nejhlubší objevy nečekají nutně za příští hvězdou. Jsou uvnitř nás utkány do vláken, která nás spojují, nás všechny.
27.7.2006 18:02 helb | skóre: 9 | blog: helb | Kralovice
Rozbalit Rozbalit vše Re: Evoluce?

A tento svět nechaly stvořit myši, ty pandimenzionální stvoření.

Přesně tak.

Ovládání hlasem? cat /dev/dsp > /dev/hda1
27.7.2006 00:55 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce?
Zrovna evoluce mě tak žere. Ale buď. Myslím, že to stačí vyjádřit jednou větou ke které není třeba nic dodávat.

Křesťanství, jeho Bůh i kreacionismus (nebo co to) jsou výsledkem evoluce. (obecně)
Copak toho není dost?
vencour avatar 27.7.2006 00:56 vencour | skóre: 56 | blog: Tady je Vencourovo | Praha+západní Čechy
Rozbalit Rozbalit vše Re: Evoluce?

Asi takhle?

:-D

Ty nejhlubší objevy nečekají nutně za příští hvězdou. Jsou uvnitř nás utkány do vláken, která nás spojují, nás všechny.
27.7.2006 01:06 frdrx | skóre: 29 | blog: frdrx
Rozbalit Rozbalit vše Re: Evoluce?
Myslím že bůh by měl uvolnit člověka pod GPL.
Patička mi slouží k tomu, abych si lépe poznal svoje příspěvky.
27.7.2006 01:09 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce?
Pokud netrváte striktně na GPL, tak zdrojáky samozřejmě dostupné máte. Že se v nich zatím neumíme zorientovat, to je věc druhá. Ale na druhou stranu, zkuste si vzít zdrojáky nějakého většího open source projektu a trochu se v nich porozhlédnout. Také vám to bude nějakou dobu trvat, než zjistíte, co a jak…
27.7.2006 01:12 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce?
Ovšem křesťané poměrně radikálně prosazují názor, že člověk pod žádnou otevřenou licencí není :-) Prskají už nad samotným nahlížením do zdrojáků, kdyby si někdo dovolil zkompilovat vlastní verzi, udělají randál jaký ještě nebyl. S něčím co jim nepatří, jak typické.
Copak toho není dost?
27.7.2006 02:09 Kyosuke | skóre: 28 | blog: nalady_v_modre
Rozbalit Rozbalit vše Re: Evoluce?
http://www.etf.cuni.cz/~rovnanim/bible/k/Mt1.php

Přečti si levý dolní roh... ;-)
27.7.2006 02:10 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce?
Tady mi tvrdili, že to byl Duch Svatý, tak já nevím :-) Ale tak, to je Bible, to jejich asi fakt je, s tím ať si dělají co chtějí :-)
Copak toho není dost?
27.7.2006 02:14 Kyosuke | skóre: 28 | blog: nalady_v_modre
Rozbalit Rozbalit vše Re: Evoluce?
Jestli jsi nepodepsal EULA, je ti jasné, že svůj DNA software používáš nelegálně? :-D Buď se ho budeš muset zbavit nebo ho zlegalizovat. :-D
27.7.2006 02:16 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce?
Kdybych mohl, už bych se té hrůzy zbavil, jenom nad tím bastlem žasnu :-) Vůbec bych se nedivil, kdyby evoluci vymyslel Bůh aby zakamufloval, že to tak podělal :-)
Copak toho není dost?
kotyz avatar 27.7.2006 11:09 kotyz | skóre: 25 | blog: kotyzblog | Radnice
Rozbalit Rozbalit vše Re: Evoluce?
pripomina mi to co se stalo ve stargate v 10. rade. tam taky jedna (vala mal doran) porodila a snikym to nemela. teda s nikym hmotnym (s nakym Ori-vyssi to energetickou bytosti)...
Mul-ti-pass! | Hrdý člen KERNEL ULTRAS. | Furry/Brony/Otaku | Nemám čas ztrácet čas. | In 'pacman -Syu' we trust!
masožravá palma avatar 27.7.2006 15:07 masožravá palma | skóre: 6 | blog: Agnes | Matka měst
Rozbalit Rozbalit vše Re: Evoluce?
Duch Svatý = Bůh. Obráceně platí Bůh = Duch Svatý + Otec + Syn. Platí také jednotlivě Syn(Ježíš Kristus) = Bůh a Otec(Stvořitel, vystupuje ve starém zákoně) = Bůh. Jasné?
Mám městečko, podpořte průmysl a dopravu. Snižujte kriminalitu.
27.7.2006 15:18 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce?
Vychází mi Bůh = Duch Svatý = Otec = Syn = 0. Pochopil jsem to správně? :-)
27.7.2006 15:31 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
Nepochopil. Správně je to takhle:
Bůh = Duch Svatý = Otec = Syn = 1(3)
27.7.2006 15:33 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
tzn. že (3=1)=(1=3)=(3=1+1+1=1) ;-)
27.7.2006 15:38 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce?
V tom případě bych poprosil o nějakou aspoň trochu funkční aritmetiku pro práci s těmi symboly a(b) resp (a=b). Jinak ten můj příspěvek, pokud to nebylo úplně jasné, byl myšlen právě jako protest proti používání standardních symbolů k zápisu něčeho, co s jejich významem nemá nic společného a kde jsou interpretovány tak, jak se zrovna dotyčnému hodí.
27.7.2006 17:08 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?

můj příspěvek... protest proti..

Souhlasím... (to já jen aby řeč nestála) :)

27.7.2006 15:19 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
Jen bych doplinl, že ve starém zákoně pod názvem Bůh vystupují všechny tři osoby (v jedné) a a někdy zase všechny tři osoby zvlášt (a přitom dohromady). Teď je to teprve jasné! :-D
27.7.2006 15:21 zabza | skóre: 52 | blog: Nad_sklenkou_cerveneho
Rozbalit Rozbalit vše Re: Evoluce?
a teď ještě tu radu, jak by se z toho měl jeden nezbláznit :-)
27.7.2006 15:22 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
.. nepřemejšlet nad tím :-D :-D
27.7.2006 15:24 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce?
O tom má být ta Kábrtova kniha, ne? Ale neřekl bych, že to funguje… :-)
27.7.2006 15:28 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
To byl pokus o vtip (proto ty dva smajlící za tím) ;-)
27.7.2006 15:26 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
...protože jádrem křesťanství je po mém soudu vztah ne rozum nebo dodržování / porušování příkazů a nařízení. Boží osoby mají spolu takový vztah, že jsou tři a zároveň jeden - to se promítá do rodiny (mělo by se promítat) i do života lidí - jde tedy o vztah s Bohem, vůči Bohu a s lidmi a vůči lidem.
27.7.2006 15:34 zabza | skóre: 52 | blog: Nad_sklenkou_cerveneho
Rozbalit Rozbalit vše Re: Evoluce?
ok, jasně, radši zůstaneme u tohohle ... ;-)
27.7.2006 15:36 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
:-D
27.7.2006 16:04 Dag | skóre: 25 | blog: bzuk
Rozbalit Rozbalit vše Re: Evoluce?
Tuším, že to byl sv. Augustín, kdo dumal nad záhadou boží trojce, procházeje se na břehu moře. V tom vidí malého chlapce, jak nabírá nalezenou mušličkou vodu z moře a vylévá jí do důlku na břehu. "Co to činíš chlapče", tázal se světec. "Chci přelít moře!" "Ale to je přeci bláhové a nemožné!" Zvolal svatý.

A přichází pointa, ten fracek prones prý něco jako: "Jasnačka ty woe, stejně jako je pro tebe nemožné pochopit tajemství trojce!" Roztáhl perutě a byl v trapu, neb to byl anděl, seslaný pro poučení. Haf haf.
masožravá palma avatar 27.7.2006 16:15 masožravá palma | skóre: 6 | blog: Agnes | Matka měst
Rozbalit Rozbalit vše Re: Evoluce?
LOL Tak takhle dobře napsané jsem to ještě neviděla. :-) +1
Mám městečko, podpořte průmysl a dopravu. Snižujte kriminalitu.
27.7.2006 16:07 Martin | skóre: 10 | blog: Nádraží Perdido
Rozbalit Rozbalit vše Re: Evoluce?
Proč je to tak zbytečně složitý? Jeden všechno nestíhá nebo co? :o)
27.7.2006 01:15 frdrx | skóre: 29 | blog: frdrx
Rozbalit Rozbalit vše Re: Evoluce?
Zdrojáky nemáme, jenom zkompilovaný kód. A ani nevíme čím.
Patička mi slouží k tomu, abych si lépe poznal svoje příspěvky.
27.7.2006 02:08 Kyosuke | skóre: 28 | blog: nalady_v_modre
Rozbalit Rozbalit vše Re: Evoluce?
Hádal bych, že to bylo asi jako když Chuck Moore dělal OKAD. Taky ho šoupal hexadecimálně do operační paměti z hlavy ;-) (Kurzorovejma šipkama... :-D) Kromě toho Chuck Moore je zřejmě slušnou aproximací Boha, umí totiž „téměř zázraky“. Takže jisté analogii bych se nedivil. :-D
kotyz avatar 27.7.2006 11:10 kotyz | skóre: 25 | blog: kotyzblog | Radnice
Rozbalit Rozbalit vše Re: Evoluce?
ja ho mam doma na cd, ale ne komplet. ale stejne to je nekolik desitek mb v ascii. na dvd se to da nekde sehnat cely (pojekt gutenberg, knizky bez copyrightu v ascii).
Mul-ti-pass! | Hrdý člen KERNEL ULTRAS. | Furry/Brony/Otaku | Nemám čas ztrácet čas. | In 'pacman -Syu' we trust!
27.7.2006 15:28 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce?
Tady byla řeč o "zdrojáku člověka".
27.7.2006 01:04 frdrx | skóre: 29 | blog: frdrx
Rozbalit Rozbalit vše Re: Evoluce?
Z principu dialog nikdy neodmítám ale jsou věcy o kterých asi nemá smysl se přít. Třeba o tom jestli je Země kulatá. Jo, je pravda že se o tom dá polemizovat, ale popřít už to nejde. Můžu se o tom sice pohádat s někým kdo urputně věří že je placatá, po čemž maximálně připustím že není až tak úplně kulatá ale přeci jen je to spíš koule než placka. A stejný mi to přijde s evolucí. Evoluce je očividný fakt. Probíhá dnes a denně a dá se to pozorovat. Její principy prostě fungujou. Jasně, každou prkotinu evoluční teorie nezahrnuje, ale to ani nemůže. Kdosi o ní napsal že nevysvětluje nic, protože vysvětluje všechno (nebo nějak tak). Studuju biologii a jeden náš kolega, kreacionista, na přednáškách vždy poslouchal a psal si. Ovšem dokud nepřišla řeč na evoluci, pak položil propisku a koukal z okna... Kreacionisté chtějí dialog ale nechtějí slyšet argumenty.
Patička mi slouží k tomu, abych si lépe poznal svoje příspěvky.
27.7.2006 01:16 Jan Jílek | skóre: 6 | blog: Strider
Rozbalit Rozbalit vše Re: Evoluce?
Jako křesťan se zajímám o evoluci. Dokonce jsem si se zájmem přečetl autory jako O. Wilson, Richard Dawkins či Matt Ridley. Uznávám, že spousta jejich závěrů je velmi blízko pravdivému poznání. Konečně vážím si jich za velmi slušné znalosti lidského chování. Nejen lidského. Tady mě skutečně okouzlil Desmond Morris. Přesto se přikláním k jistému kreacionismu, který obsahuje i evoluci jako součást vyššího úmyslu a plánu. Takže argumenty vyslechnu, ale co vím jsou i proti argumenty.
Čas od času jsem sražen k zemi. Ale vždy vstanu a nedovolím nikomu držet mě na zemi.
27.7.2006 01:22 frdrx | skóre: 29 | blog: frdrx
Rozbalit Rozbalit vše Re: Evoluce?
V životě jsem žádný protiargument (pro mě rozumný) neslyšel ani nečetl. Jenom pořád dokola věcy jako: "Já jsem tak krásný, chytrý a dokonalý že není možné abych vznikl náhodou", "Vždyť duše je nehmotná, tak jak mohla vzniknout z přírody" a podobně. Omlouvám se.
Patička mi slouží k tomu, abych si lépe poznal svoje příspěvky.
Evoluce je očividný fakt. Probíhá dnes a denně a dá se to pozorovat. Její principy prostě fungujou.
To myslim Kabrt taky popisuje. Nepopira takove veci jako je prizpusobovani se zvirat prostredi (dilci veci, tvary zobaku atp.), ale hlavne nesouhlasi s nekterymi vyvojovymi skoky...tohle z tohohle a tak... chce si to precist nebo se s nim pobavit.

Jinak ten vas kolega kreacionista. takovych je asi dost. Ale mnohem vic takovych je na druhe strane barikady, to je zjevne.
FSF: “screw you for not wanting the stuff we produce”, People: “screw you for not producing the stuff we want."
27.7.2006 01:23 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce?
Já jsem taky žádné skoky neviděl. Ale přeci jenom, nějaké ty milióny a miliardy let jsou pro mě víc než mrknutí oka.
Copak toho není dost?
David Watzke avatar 27.7.2006 01:19 David Watzke | skóre: 74 | blog: Blog... | Praha
Rozbalit Rozbalit vše Re: Evoluce?
Jaký je váš názor na stvoření a vývoj světa?
Na stvoření žádnej, protože si to nikdo nepamatuje a všichni jen hádaj :-) (a většinou jsou to kraviny :-)).
“Being honest may not get you a lot of friends but it’ll always get you the right ones” ―John Lennon
27.7.2006 01:21 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce?
Pokud jde o tu knihu, je celá i na webu, není nutné stahovat ptákoviny ještě v pdf. Viděl jsem k tomu i polemiku, bohužel ji nemohu najít.

Kdo to ještě neviděl, připravte si už při čtení obsahu pytlík na blití.
Copak toho není dost?
27.7.2006 01:25 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce?
No, poté, co jsem absolvoval poměrně dlouhé debaty s lidmi, kteří vážně tvrdili, že podle nich je svět starý asi 20000 let, a co jsem někde dostal atlas světových dějin, který začínal stvořením světa 4004 př. n.l., už mne asi nemá co překvapit.
27.7.2006 01:27 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce?
Tak toto přesvědčení vám závidím :-) Nebo možná ne, jestli to chcete číst :-)
Copak toho není dost?
27.7.2006 01:29 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce?
Chci tím jen říct, že zhruba tuším, co mohu očekávat, protože podobnou argumentaci už jsem párkrát viděl nebo slyšel. Ale tím spíš si to nechám na jindy, teď na to nemám náladu.
27.7.2006 01:34 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce?
Ještě jedno (to je na autora článku), totiž proč vlastně označil toho pána za vědce. Jestli vypadá vědecká publikace tak, že ,,teď vám řeknu, že tohle je blbost, ti lidé co říkají ne vám lžou a já vám řeknu proč: protože to tak není``, asi mám trochu špatnou představu.
Copak toho není dost?
27.7.2006 02:02 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce?
Tak ne, opravdu je to horší, než jsem čekal. Ale ne kvůli těm kapitolám o evoluci, tam mne zaskočil spíš jen mimořádně nenávistný tón textu, jinak je to pořád stejná obehraná písnička. Zato některé z těch dalších "omylů", to je opravdu silná káva. Nadávky a urážky místo argumentů, neustálé sebepotvrzování (je to tak, protože to tak prostě je), absolutní intolerance k sebeméně odlišnému názoru nebo chování a to celé neustále prokládáno řečmi o lásce a porozumění… Opravdu velmi smutné čtení…
masožravá palma avatar 27.7.2006 15:52 masožravá palma | skóre: 6 | blog: Agnes | Matka měst
Rozbalit Rozbalit vše Re: Evoluce?

Je to opravdu dost zlé. Ten, co to psal snad při tom vůbec nemyslel!

Sice s některými omyly souhlasím (6,7,8,10,12,14,19,20,21,25,26,30,31), nebo alespoň s jejich nadpisy celé jsem je neměla chuť zatím číst.

K jiným mám jen menší námitky: 3 - náhoda je všude stejná, ale výsledky, které se z toho snaží autor vyvodit, úplně korektní nejsou; 9 - muž a žena nejsou stejní a je chybou tvrdit, že jsou, ale muž i žena jsou především lidé; 11 - demokracije je nejhorší státní uspořídání, ale je to to nejlepší, co jsme schopni uskutečnit; 16 - monotheistická náboženství si jsou podobná (ty dnešní tři); 17 - i blázen může věřit v Boha; 20 - pro každého je lepší slyšet pravdu než lichotky, jedině tak se totiž může něco zmenit; 22 - duše i tělo jsou stejně důležité, Bůh staví na lidské přirozenosti, najedené a vyspalé; 27 - ani jedno ani druhé; 29 - je dobré o náboženství něco vědět, možná něco málo zařadit do dějepisu, ale rozhodně bych to s tou poviností tak nepřeháněla a poku by bylo poviné tak se neučit jen o křesťanství; 32 - je dobré si nechat poradit, ale není dobré někomu rady vnucovat, rozhodnout se nakonec musí každý sám.

S bodem 33 souhlasím také, ale nějak se mi příčí na konci zrovna tohoto seznamu. Body, které jsem nevyjmenovala považuji buď za nesmysly úplné, nebo můj názor na ně vyplývá z názorů na jiné body.

Až/pokud si to přečtu celé, možná se seznam bodů, se kterými souhlasím, výrazně ztenčí.

Mám městečko, podpořte průmysl a dopravu. Snižujte kriminalitu.
27.7.2006 15:59 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce?
U dvacítky není problém v tom nadpisu, ale v tom, co on považuje za tu pravdu.
vencour avatar 27.7.2006 01:27 vencour | skóre: 56 | blog: Tady je Vencourovo | Praha+západní Čechy
Rozbalit Rozbalit vše Re: Evoluce?

To jsou právě "věci", kterými se dříve zabývali více, než třeba matematikou.

Ty nejhlubší objevy nečekají nutně za příští hvězdou. Jsou uvnitř nás utkány do vláken, která nás spojují, nás všechny.
27.7.2006 01:30 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce?
Já vím. Jenže to neznamená, že je za to budu chválit.
27.7.2006 01:37 tired joe | skóre: 17 | blog: rootlet | Trenčín/Bratislava
Rozbalit Rozbalit vše Re: Evoluce?
... kniha křesťanského vědce ... To myslíte vážne? Môže mať vedec štýl písania ako pubertálny stredoškolák?

Nedělám si žádné iluze, že by se mnou mnoho lidí souhlasilo. Již první reakce e-mailem byla stručná: „Jste idiot.“ Když jsem slušně požádal o vysvětlení, v čem se mýlím, odpověď už nepřišla.

Ani sa nečudujem.

Človek sa riadi zdravým rozumom, až keď už nezostáva žiadne iné riešenie.
27.7.2006 01:41 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce?
Ta knížka je psaná asi takovým stylem, jako kdyby si autor řekl: ,,když naštvu co nejvíc lidí, budou se o mně bavit a při trošce stěstí si ti co to nepřečetli budou myslet, že na tom něco je``.
Copak toho není dost?
27.7.2006 01:50 tired joe | skóre: 17 | blog: rootlet | Trenčín/Bratislava
Rozbalit Rozbalit vše Re: Evoluce?
JJ. Čím viac z tej knihy čítam, tým viac mám pocit, že idiot je slabé slovo. Ten "vedec" nepozná ani logické pravidlá.

Myslím, že keby toto čítal Dawkins, určite by ho porazilo.

Je to hnus.
Človek sa riadi zdravým rozumom, až keď už nezostáva žiadne iné riešenie.
27.7.2006 01:53 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce?
Přečetl jsem si těch pár kapitol u kterých si myslím, že se toho týkají, na víc nemám ani zdaleka chuť ani žaludek. Zajímalo by mě, co na nich tolik diskredituje nějakou evoluci či co. Spíš autora. Argumenty žádné a když, nesmyslné. Spíš jenom urážky a výsměch. Skvělá věda.
Copak toho není dost?
27.7.2006 02:02 tired joe | skóre: 17 | blog: rootlet | Trenčín/Bratislava
Rozbalit Rozbalit vše Re: Evoluce?
Mňa by ešte zaujímalo, ako tú knihu hodnotia kresťania.
Človek sa riadi zdravým rozumom, až keď už nezostáva žiadne iné riešenie.
27.7.2006 01:38 xkesh | skóre: 46 | blog: eXtempore
Rozbalit Rozbalit vše Re: Evoluce?
Tyto debaty většinou trpí tím, že jejich iniciátoři zpravidla opomenou definovat, o čemže se to vlastně chtějí bavit. Pak sice používají diskutéři tatáž slova, ale už ne tytéž pojmy. Zvláště co se týká takovýchto principiálních otázek, mluví zpravidla jeden o voze a druhý o koze.

Snadno se plácne heslo "evoluce" nebo "darwinismus", aniž by někdo byť jen nahlédl do té slavné Darwinovy knížky (btw. existuje i český překlad moderního "light" přepracování, mělo by být v knihovnách), snadno se plácne "kreacionismus" a nemyslí se na případné mezery Darwinovy teorie nebo konkurenční pohledy, ale na náboženské fundamentalisty z TV-zpráv.

Pokud to autora blogpostu skutečně zajímá, doporučil bych mu, aby než vyvolá další flamewar nejdříve stručně zrekapituloval, co si pod zmíněnými pojmy vlastně představuje.

Vědecké teorie vznikají obvykle jako odpovědi na určité otázky, například prokazatelně pozorované mutace v rámci jednoho druhu v závislosti na životním prostředí a možností obživy, a když se nějaká teorie ujme, znamená to, že na otázky odpovídá poměrně přesvědčivě - alespoň do té doby, než někdo najde něco lepšího.

Takže až se pokusíte zodpovědět otázky jedné teorie odpověďmi teorií konkurenčních, můžete s čistým svědomím původní teorii kritizovat. Tyto odpovědi nemusí být vůbec odborné nebo vyčerpávající, ale měly by být poctivé na úrovni znalostí, které máte nebo které jsou vám snadno dostupné.

Už při tom velice snadno zjistíte, že ona ostře formulovaná otázka "evoluce" nebo "kreace" měla sice své místo v dobách polemiky proti populárním církevním učením a hrála roli v emancipaci biologických věd, ale že je dnes prakticky bezpředmětná a jako taková nehraje roli ve vědeckém diskursu, ale pouze mezi ideologickými tábory věřících (jedné i druhé strany).

Jejím zodpovězením se totiž objektivně nezmění vůbec nic; nedostaneme se v odpovědi na otázku vzniku života ani o krůček dál.

Takže než se rozhodnete takto zeptat, měl byste asi nejdřív formulovat, na co zodpovězením této své otázky chcete vlastně přijít. Od toho se pak možná může vyvíjet i přínosnější diskuse než jen další flamewar.
27.7.2006 02:07 micks | skóre: 4 | blog: Old_School | Olomouc
Rozbalit Rozbalit vše Re: Evoluce?

Hm, keby bol Pierre Teilhard de Chardin nažive a počul by, že ste tohoto človeka nazvali "kresťanský vedec", asi by mal chuť niekoho umlátiť paleontologickou lopatkou...

elviin avatar 27.7.2006 09:12 elviin | skóre: 29 | blog: elviin | Plzeň-Praha
Rozbalit Rozbalit vše Re: Evoluce?
Na teto strance si muzete za 30 korun koupit DVD z konference, ktera diskutovala tohle tema. Vcetne poznamek pana Kabrta. http://www.darwinanddesign.org/page_06cz.htm
27.7.2006 09:23 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
Podobných knih na toto téma je spousta. Docela zajímavá byla i kniha s názvej "Jablko sváru". Měla by být i někde na netu. Zkusím se podívat...
27.7.2006 09:30 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
Takže tady nebo v pdf tady.
Existují i zajímavé dokumenty, jako např. fotografie zkameněliny trilobita rozšlápnutého lidskou nohou, nebo zkamenělý strom, který jde napříč vrstvami, které se podle evolucionalistů ukládaly miliony let... atd.
Mikos avatar 27.7.2006 17:01 Mikos | skóre: 34 | blog: Jaderný blog | Praha
Rozbalit Rozbalit vše Re: Evoluce?
Jo... a taky existuje spousta fotografií ufounů, létajících talířů, rarášků, skřetů, víl a já nevim čeho všeho ještě ;-)

Pro lidi jako ty existuje jedno výstižné označení - "crackpot" (případně "crank"). I když tohle se většinou týká různých "pseudovědců", pro tebe a tobě podobné je možná lepší označení prostě a jednoduše "náboženský fanatik" (či "vygumovaný mozek", což je pro náboženského fanatika prakticky synonymum :-))
CETERUM CENSEO DRM ESSE DELENDAM Ostatně soudím, že DRM musí být zničeno!
27.7.2006 17:19 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
No, škoda, že je tato odpověď argumentačně naprosto lichá (snad až kromě první věty). Kdybys místo osobních útoků použil argumenty, bylo by to lepší.
27.7.2006 17:41 Michal Vyskočil | skóre: 60 | blog: miblog | Praha
Rozbalit Rozbalit vše Re: Evoluce?
Nemám argumenty, jenom otázku. To myslíš třeba tohoto rozšlápnutého trilobita?
When your hammer is C++, everything begins to look like a thumb.
27.7.2006 18:34 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?

To je fakt trilobit? (nějakej malej, ne? ;-))
Upřímně řečeno, fakt nevím. Je to dost dávno, co jsem něco takového četl.
Použil jsem to jako příklad toho, že se má nad věcmi přemýšlet a ne je apriori zavrhnout dřív, než zná člověk protiargumenty. Protože je stále dost lidí, kteří považují evoluční teorii za jedinou a jedině správnou a strašně se ježí, když má někdo jiný názor.

Myslím, že je to nedostatkem informací. Mně například úvaha o hloubce prachu na Měsíci v souvislosti dobou jeho usazování a dobou otázkou nad stářím Země a vesmíru připadala zajímavá. Stejně jako úvaha o evoluci a vývoji oka atd. - rozhodně by mne dřív nenapadlo o tom takto (= jinak) uvažovat..

A pokud je ta paní, co to napsala doktorka a kandidátka věd, tak by o tom aspoň trochu něco IMHO vědět měla? Seriózní přístup je přečíst to a napsat: Tady a tady je to blbě, protože... To má smysl.

K argumentům: Proto jsem psal: kromě první věty, protože např. brát v úvahu možnost fotomontáží a falzifikací mi připadá naprosto legitimní. K tomu je však třeba dodat, že mají obě strany své "důkazy" a vzájemně se obviňují z falzifikace.

27.7.2006 18:42 Kyosuke | skóre: 28 | blog: nalady_v_modre
Rozbalit Rozbalit vše Re: Evoluce?
Úvaha o hloubce měsíčního prachu je zcestná, protože NASA se ničeho takového neobávala. Navíc soudobé teorie o "hlubokém oceánu prachu" nebyly přijímány tak, jak se nám autorka snaží vsugerovat. Navíc ani doktorát není zárukou, že někdo není magor.
27.7.2006 18:53 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
Úvaha o hloubce měsíčního prachu je zcestná, protože NASA se ničeho takového neobávala.
Samozřejmě, protože jim bylo jasné, že tam toho prachu tolik není.
Navíc soudobé teorie o "hlubokém oceánu prachu" nebyly přijímány tak, jak se nám autorka snaží vsugerovat.
Opravdu? Já bych řekl, že reaguje na něco v čem žije (žila).
Navíc ani doktorát není zárukou, že někdo není magor.
To je pravda. Ale slovo "navíc" bych vypustil, protože to také automaticky neimplikuje to, že magor je.

Poznámka: Přijde mi nefér předpokládat, že akademik hájící evoluci není nejspíš není magor (protože přece hájí evoluci) zatímco akademik stojící na pozicích kreationismu magor automaticky je (protože přece nehájí evoluci).

27.7.2006 19:19 Kyosuke | skóre: 28 | blog: nalady_v_modre
Rozbalit Rozbalit vše Re: Evoluce?
Samozřejmě, protože jim bylo jasné, že tam toho prachu tolik není.
Ale to je snad očividné, když to bylo podepřeno dřívějšími přistáními vesmírných sond, ne? Co je tohle za argument? Jak někdo může tvrdit, že „evolucionisté byli tímto zjištěním velmi překvapeni,“ když nebylo čím být překvapený? Zase nějaké lhaní a sugerování?
Opravdu? Já bych řekl, že reaguje na něco v čem žije (žila).
I kdyby někdo býval v šedesátých letech měl nějaké bláhové představy o stovkách metrů prachu na měsíci, co to má společného s dneškem, kdy máme poněkud jiné informace? Prostě je to překonané, nechápu, co na tom chcete ještě řešit.
To je pravda. Ale slovo "navíc" bych vypustil, protože to také automaticky neimplikuje to, že magor je.

Poznámka: Přijde mi nefér předpokládat, že akademik hájící evoluci není nejspíš není magor (protože přece hájí evoluci) zatímco akademik stojící na pozicích kreationismu magor automaticky je (protože přece nehájí evoluci).

To jsem netvrdil, tak mi to nepodsouvejte. Naopak Vy implikujete, že doktorát a titul kandidáta věd znamená, že by o tom něco vědět měla. Pokud vím, je to bioložka, ne astronomka. Tudíž mi argument „ale ona je přece doktorka“ přijde jako trošku zcestný. Mohla o tom vědět hodně stejně jako skoro nic. Každopádně to není její obor o nic víc než můj.
27.7.2006 19:40 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?

1) Mně se na tom zdá být zajímavý ten argument, že pokud by byl měsíc tak starý jak se předpokládá při evoluci, prachu by tam mělo být víc. To zní podle mne logicky. Jestli byl někdo překvapen nebo ne, to fakt nevím. :-(
2) S dneškem to má společného to, že i vědecké názory, které vypadají nevyvratitelné a pevné se mohou v průběhu času přehodnotit a změnit.
3) Pochopil jsem to tak. Pokud to tak není, omlouvám se. S tím titulem přírodních věd si myslím, že by o tom člověk něco vědět měl a to na obou stranách. Rozhodně o tom ví víc než třeba já. Její obor jistě není víc nebo míň, přijde mi k problému rozhodně bližší (přiklad z měsícem je příklad který MNE zaujal, jsou tam i další z oblasti biologie...).
4) Kdyby to bylo možné, poprosil bych, jestli bychom si mohli tykat. (Je to pro flame praktičtější ;-) (to byl vtip));-)

PS: Tykání je myšleno vážně. Díky!
27.7.2006 19:57 Kyosuke | skóre: 28 | blog: nalady_v_modre
Rozbalit Rozbalit vše Re: Evoluce?
Stupeň specializace ve vědách dosáhl takové míry, že si nedělám iluze o polyhistorství jakéhokoli doktora přírodních věd... :-D Viděl jsem odhad, podle kterého by prach napadaný na Zemi za celou její existenci vyšel na nějakých 60 cm povrchu, a to podle posledních měření (sobě blízkých měření několika nezávislých experimentátorů). To je docela zanedbatelné. ;-) Sice dřív byly asi ty nánosy větší, ale v dobách, kdy mohly být opravdu velké, docházelo zřejmě ještě ke slušné geologické aktivitě a sluneční vítr náš planetární systém vysmýčil zřejmě docela záhy. A navíc:

http://www.answersingenesis.org/creation/v15/i4/moondust.asp
27.7.2006 19:59 Filip Jirsák | skóre: 67 | blog: Fa & Bi
Rozbalit Rozbalit vše Re: Evoluce?
Kreacionisté již argument s měsíčním prachem nepoužívají, protože nová měření dala podstatně nižší hodnoty objemu spadu za časovou jednotku.
Poznámka P.K. k Jablku sváru a prachovému argumentu zde. Co tam máte dál? :-)
27.7.2006 20:13 Kyosuke | skóre: 28 | blog: nalady_v_modre
Rozbalit Rozbalit vše Re: Evoluce?
Evoluční vědci se snaží tento problém obejít tvrzením, že helium překonává gravitaci a uniká z atmosféry, ale není o tom žádný důkaz.
Opět, typické ignorování argumentů a překrucování reality. :-( Pokud je mi známo, je únik hélia z atmosféry v rovnováze s jeho předpokládanou produkcí, což je zcela dobře očekávatelný ustálený stav, ze kterého se dá těžko soudit na nějaký časový údaj.
27.7.2006 20:56 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
Díval jsem se do textu:
Američtí vědci ze střediska NASA se obávali, že měsíční modul, který měl v roce 1969 dosednout poprvé s lidskou posádkou na měsíční povrch, se zaboří do obrovského množství prachu, usazeného za miliony let předpokládaného stáří Měsíce.
Úvaha o hloubce měsíčního prachu je zcestná, protože NASA se ničeho takového neobávala...
No to je tedy argumentace...(!) To je tvrzení proti tvrzení. Jak to rozsoudit? Leda zavolat do NASA a zjistit, jak to doopravdy bylo. Je tu ale riziko, že by telefon mohl zvednout evolucionalista / kreativista a tak bychom se pravdu nesjpíš nedozvěděli...
27.7.2006 21:02 Filip Jirsák | skóre: 67 | blog: Fa & Bi
Rozbalit Rozbalit vše Re: Evoluce?
Rozsoudit to lze jednoduše, sám P.K. přiznává (příslušná citace zde v diskuzi), že to není pravda…
27.7.2006 21:10 Kyosuke | skóre: 28 | blog: nalady_v_modre
Rozbalit Rozbalit vše Re: Evoluce?
A proč na to reagujete znovu? Kromě toho v odpověď na vaši první reakci jsem podsunul jistý argument. ;-)
Mikos avatar 27.7.2006 18:49 Mikos | skóre: 34 | blog: Jaderný blog | Praha
Rozbalit Rozbalit vše Re: Evoluce?
Však taky se nad tím lidé legitimně zamýšlí, tady máš možné vysvětlení tvé "stopy": Zašlápnutý trilobit

Jinak opravdu doporučuji přečíst si stránky Teorie kreace na serveru Planetopia. Ty pseudoargumenty Kábrta a jemu podobných jsou tam krásně logicky takříkajíc "rozneseny na kopytech". A to vše vědeckou cestou podpořenou reálnými argumenty a fakty.
CETERUM CENSEO DRM ESSE DELENDAM Ostatně soudím, že DRM musí být zničeno!
27.7.2006 18:59 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
Problém je, že se mi zase tak jednoznačně roznesené na kopitech nezdají. Ale zajímavé to je, to ano.
27.7.2006 19:11 Filip Jirsák | skóre: 67 | blog: Fa & Bi
Rozbalit Rozbalit vše Re: Evoluce?
Co je na nich nejednoznačného?
masožravá palma avatar 27.7.2006 19:13 masožravá palma | skóre: 6 | blog: Agnes | Matka měst
Rozbalit Rozbalit vše Re: Evoluce?
Přinejmenším nenadávají jako Kábrt. To jim na důvěryhodnosti hodně přidává.
Mám městečko, podpořte průmysl a dopravu. Snižujte kriminalitu.
27.7.2006 19:28 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
That's right!
27.7.2006 19:25 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?

PS: Chci jen znovu říct, že se nechci dostat na extrémní (extrémistickou ) stranu, která se zakope a hájí své pozice.

Bylo by naivní se domnívat, že někdo z nás je schopen přesvědčit někoho z opačného tábora o své pravdě - na to tomu všichni příliš málo rozumíme ;-)

Chci k tomu ale říct několik svých osobních poznámek:
Já jsem články pana Kábrta nečetl. Ale jsem rád, že se tím tady aspoň někdo zabývá.
Myslím, že je to dobře, protože je to v postkomunisticko - ateistické mentalitě našeho národa silně nepopulární, ale zároveň zdravé, protože to boří navyklé myšlenkové pevnosti a nutí to lidi přemýšlet (alespoň některé). V tomto smyslu bych panu Kábrtovi i některé chyby odpustil.. ale jak říkám, nečetl jsem to, nevím tedy kolik jich je a jak velmi jsou zásadní.

Já jsem před lety četl knihu Jablko sváru (tehdy ještě jako samizdat)
a oslovilo mne to, protože do té doby jsem znal pouze "evolucionalistický" pohled (a měl jsem na kreacionalalisty podobné názory, jako někteří zde). Časem jsem si utvořil názor a musím říct, že dnes osobně stojím na opačné - tj. kreationalistické straně.

Militantní postoj mi ale vadí ( na obou stranách). Protože militantní postoj je výsledkem neschopnosti argumentace a neochoty slyšet. (a asi ještě ze spousty jiných důvodů...)

27.7.2006 19:53 Filip Jirsák | skóre: 67 | blog: Fa & Bi
Rozbalit Rozbalit vše Re: Evoluce?
Myslím, že je to dobře, protože je to v postkomunisticko - ateistické mentalitě našeho národa silně nepopulární, ale zároveň zdravé, protože to boří navyklé myšlenkové pevnosti a nutí to lidi přemýšlet (alespoň některé).
To tedy nevím, ale když v nějakém textu vidím spoustu bludů, nijak mne to nenutí o zbytku přemýšlet. Maximálně přemýšlím o tom, proč na ten blud někdo naletí.

No a když v Jablku sváru čtu:
Za prvé je jisté, že k nim [mutacím] dochází. Za druhé je též jisté, že každá větší změna v genu je vždy změnou k horšímu. To je to, co bychom očekávali.
Začnu první větu je jisté a doplním věc, se kterou pravděpodobně většina lidí souhlasí. Začnu další větu je též jisté, a doplním nesmysl. Aneb co je napsáno vedle pravdivého tvrzení musí být také pravda…
Populární, avšak nedokázaná teorie tvrdí, že se změnily relativní pozice kontinentů. Sférická slupka země se prý rozlomila asi do dvanácti ostrých desek, které se pohybují. Výsledek je pohyb kontinentů (jako nesené zavazadlo na transportéru). I kdyby to bylo tak, je nepravděpodobné, že by se to událo v takové míře. Že by každá část světa v některé době byla přenesena do subtropické nebo tropické oblasti.
Himaláje, Alpy, zemětřesení, cunami – to jsou všechno nesmysly. Autorka tomu prostě nevěří. A to přece jako důkaz stačí, ne?
Je pravda, že v malém měřítku starší, to je níže spočívající skála, může být posunuta podél horizontálních trhlin přes mladší skálu, která před tím byla nad ní. Tento jev však nemůže vysvětlit přesuny, které jsme citovali. … Navíc je zřejmé, že potřebné síly k přesunu jen malých skal musí být obrovské.
A pokud jste snad někdy viděli geologické vrstvy zvrásněné, zprohýbané, šikmé nebo dokonce vertikální, nic to neznamená. Autorka to nikdy neviděla a nedovede si to představit, tak to neexistuje.
Za druhé není známé žádné rašeliniště, které by ve svých spodních vrstvách přecházelo v typické uhelné ložisko.
A není známá žádná tužka, na kterou když se přitlačilo, vzniknul diamant… Tady už člověk začíná vážně pochybovat o soudnosti autorky.

To je zajímavé, jak obhájci kreacionizmu mají společné to, že nepřipouští jevy, které by trvaly dlouho – stovky, tisíce a miliony let. Prostě oni za svého života ten jev nezaznamenali, tak neexistuje…
27.7.2006 21:24 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
...když v nějakém textu vidím spoustu bludů ..., nijak mne to nenutí...
Otázkou je, jsou - li to opravdu bludy...
No a když v Jablku sváru čtu: Za prvé je jisté, že k nim [mutacím] dochází. Za druhé je též jisté, že každá větší změna v genu je vždy změnou k horšímu. To je to, co bychom očekávali.
Ale tomu ještě nějaká argumentace předchází, že? Tedy, že genetická banka "slábne" namísto sílí. To se mi zdá mnohem logičtější než bizarní teorie o vznku nových druhů. Všude okolo je naprosto zřejmě vidět, že se situace zhoršuje, ne zlepšuje. Příroda se nezvládá "sama přispůsobovat", jednotlivé živočišné druhy vymírají,jejich odolnost klesá. A nové nevznikají. Snaha o poskládání kostí starověkého zvířete - aby se vyplnila díra v evoluční posloupnosti - o kterých se po čase ukáže, že k sobě nepatří - hmmm.
Himaláje, Alpy, zemětřesení, cunami – to jsou všechno nesmysly. Autorka tomu prostě nevěří. A to přece jako důkaz stačí, ne?
Nevím, ale podle mne se o tomto zde vůbec nepíše? Ani nerozumím tomu, jak jsi to pochopil (?) :-(
...Autorka to nikdy neviděla a nedovede si to představit, tak to neexistuje.
Opět vytrženo z kontextu: Autorka netvrdí, že to nikdy neviděla, ale že Tento jev však nemůže vysvětlit přesuny, které jsme citovali. Tak nevím, připadá mi to, jakobychom oba četli jiný text. Dívné, že..?
27.7.2006 21:26 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce?
Všude okolo je naprosto zřejmě vidět, že se situace zhoršuje, ne zlepšuje. Příroda se nezvládá "sama přispůsobovat", jednotlivé živočišné druhy vymírají,jejich odolnost klesá. A nové nevznikají.

Opět stejný problém: vám to připadá naprosto zřejmé. Mně to nepřipadá zřejmé ani trochu.

27.7.2006 21:48 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?

To ale opravdu nechápu :-(.

27.7.2006 22:02 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce?
Možná jste měl na mysli situaci z posledních asi tak 200 let, kdy v důsledku prudkého rozvoje lidské civilizace došlo příliš rychle k výrazným změnám životního prostředí, na což přirozené mechanismy nestihly tak rychle zareagovat (ale kdo ví, možná to naopak povede k akceleraci vývoje, podobně jako podle některých teorií na konci druhohor). Tam by se skutečně dalo mluvit o tom, že druhů, hlavně vyšších živočichů, ubývá. Jenže z hlediska toho, zda současné druhy vzniky evolucí, je tato doba naprosto nevýznamná. A pokud jste mluvil o dlouhodobějším časovém úseku, pak nevím o ničem, co by svědčilo pro vaše tvrzení, spíš naopak.
27.7.2006 22:20 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
...v důsledku prudkého rozvoje lidské civilizace došlo příliš rychle k výrazným změnám životního prostředí, na což přirozené mechanismy nestihly tak rychle zareagovat
...moment, ale to je přece také evoluce .. ten prudký rozvoj. Tzn., že je tu riziko, že by evoluce zničla sám sebe, protože by se nezvládla dál vyvíjet...
(ale kdo ví, možná to naopak povede k akceleraci vývoje, podobně jako podle některých teorií na konci druhohor).
... možná 8-)
... je tato doba naprosto nevýznamná.
Ano, tento argument dobře znám.
A pokud jste mluvil o dlouhodobějším časovém úseku, pak nevím o ničem, co by svědčilo pro vaše tvrzení, spíš naopak.
Tomu nerozumím.

Abych se přiznal, celá diskuze byla pro mne docela příjemným zpestřením mezi pracovními povinostmi.. v tomhle hrozném horku. Už to ale nestíhám.. :-) Někde jsem se docela pobavil, někde to bylo docela zajímavé. Nechci se nikoho dotknout, ale ze zkušenosti vím, žepodobné "flame" nakonec končívají špatně. Takže se s dovolením stáhnu.

Díky za čas, za trpělivost :-) Dobrou.

27.7.2006 22:28 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce?
...moment, ale to je přece také evoluce .. ten prudký rozvoj. Tzn., že je tu riziko, že by evoluce zničla sám sebe, protože by se nezvládla dál vyvíjet...

To se samozřejmě může stát, příkladů takových dynamických systémů jsou spousty. Osobně si ale spíš myslím, že by tady zafungovala zpětná vazba v tom smyslu, že jak by se svět začal blížit skutečné krizi, vedlo by to neodvratně k výraznému zpomalení toho vývoje. Tak či onak si nemyslím, že by se s tím evoluční mechanismy nakonec nějak nevypořádaly; proto jsem také do té věty, kterou jste citoval, napsal slova "tak rychle". Prostě ta doba je příliš krátká na to, abychom pozorovali podstatné změny u vyšších živočichů. Protože, přiznejme si to, na ty obvykle myslíme především - ale třeba u hmyzu nebo mikroorganismů už změny patrné jsou.

27.7.2006 21:49 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
Mám tu ještě jeden postřeh pro "drastické odlehčení"

Tak vezmeme přiklad od jinud,ne?
Zajímavý je třeba zápis kata Mydláře v jeho pamětech. Například popisuje, že se fyzická kondice popravovaných výrazně zhoršuje
(dokumentováno i jeho předchůdci).

(Je tedy fakt, že kat Mydlář popisuje i jiné věci, napřiklad experimenty s tím, že sťatému opět vrátili hlavu na její místo. Takový člověk prý ještě několik okamžiků žil (dokonce snad i udělal několik kroků(!)

PS: Nedělám si legraci, on to fakt zcela vážně (a docela podrobně ) popisuje... (!)

27.7.2006 21:53 Kyosuke | skóre: 28 | blog: nalady_v_modre
Rozbalit Rozbalit vše Re: Evoluce?
Fyzická kondice popravovaných se může výrazně zhoršovat z mnoha různých důvodů... :-) A co třeba fakt, že průměrná délka života je čím dál tím vyšší? ;-)

Mimochodem, pokud budu kreacionisticky extrapolovat, znamená to, že lidé ve starověku byli museli být nepopravitelní. :-D
27.7.2006 22:01 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
Fyzická kondice popravovaných se může výrazně zhoršovat z mnoha různých důvodů... :-)
Ano, ale ne, pokud je to zaznamenáváno po několik generací.
A co třeba fakt, že průměrná délka života je čím dál tím vyšší? ;-)
Vzhledem k vyššímu životnímu standardu, lepší lékařské péči. Kdyby nebyla, věk by se (myslím) nezvyšoval...

Mimochodem, pokud budu kreacionisticky extrapolovat, znamená to, že lidé ve starověku byli museli být nepopravitelní. :-D
:-D :-D :-D Dovedeno ad absurdum ano! :-D :-D :-D
27.7.2006 22:06 Kyosuke | skóre: 28 | blog: nalady_v_modre
Rozbalit Rozbalit vše Re: Evoluce?
Nebyl by ohledně toho Mydláře odkaz na konkrétní materiály? Kdysi jsem si okrajově nastudoval vývoj lidského fenotypu v českém středověku, ale tohle jde nějak mimo mě. Každopádně mi to nějak nezapadá. :-) (Tak se rád poinformuju. ;-))
27.7.2006 22:08 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
Mrzí mne to (a nechci se vymlouvat) ale měl jsem to půjčené a už ani nevím od koho. Pamatuju se jen, že to byly jeho paměti. Omlouvám se, víc nevím.. můžu se poptat, ale vzhledem, že jsem se stěhoval a okruh známch se změnil, je pravděpodobnost poměrně malá. Co takhle nějaká vědecká knihovna?
27.7.2006 22:28 Kyosuke | skóre: 28 | blog: nalady_v_modre
Rozbalit Rozbalit vše Re: Evoluce?
Nakouknu. Každopádně hromadu historických pramenů tohoto typu je třeba brát opatrně a s rezervou. :-) Nejen kvůli hlavám experimentálně nasazovaným zpátky na krky... :-D
27.7.2006 22:38 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
Jasně :-)
28.7.2006 10:39 Jiří Veselský | skóre: 30 | blog: Jirkovo | Ostrava
Rozbalit Rozbalit vše Re: Evoluce?

Paměti Katovské Rodiny Mydlářů napsal Josef Svátek v 19. století. Je to zhruba stejně historicky hodnověrné čtení, jako díla Jiráskova (Svátek je ovšem podstatně čtivější).

27.7.2006 21:50 Kyosuke | skóre: 28 | blog: nalady_v_modre
Rozbalit Rozbalit vše Re: Evoluce?
Nápodobně. Já si toho taky nevšimnul... :-)
27.7.2006 22:12 Filip Jirsák | skóre: 67 | blog: Fa & Bi
Rozbalit Rozbalit vše Re: Evoluce?
Otázkou je, jsou - li to opravdu bludy...
Některé z prezentovaných "faktů" jde vyvrátit na základě pouhého pozorování běžných zkušeností ze života, některé se základními znalostmi z nějakého oboru, na některé je třeba složitějších vědeckých teorií. Proč přijímat zrovna tu kterou vědeckou teorii a ne nějaký neověřitelný výmysl, ze kterého nelze nic odvodit, je zřejmé z pravidla tzv. Occamovy břitvy.
No a když v Jablku sváru čtu: Za prvé je jisté, že k nim [mutacím] dochází. Za druhé je též jisté, že každá větší změna v genu je vždy změnou k horšímu. To je to, co bychom očekávali.
Ale tomu ještě nějaká argumentace předchází, že? Tedy, že genetická banka "slábne" namísto sílí. To se mi zdá mnohem logičtější než bizarní teorie o vznku nových druhů. Všude okolo je naprosto zřejmě vidět, že se situace zhoršuje, ne zlepšuje. Příroda se nezvládá "sama přispůsobovat", jednotlivé živočišné druhy vymírají,jejich odolnost klesá. A nové nevznikají. Snaha o poskládání kostí starověkého zvířete - aby se vyplnila díra v evoluční posloupnosti - o kterých se po čase ukáže, že k sobě nepatří - hmmm.
Změna v genu je vždy k horšímu je v tomto místě prezentováno poprvé. To že jde vše od desíti k pěti je zase tvrzení autorky, ničím nepodložené. Jediný důkaz by snad mohlo být to, že autorka jako malá holka o věcech přemýšlela, ale jak spěje všechno k horšímu, zhoršuje se i její schopnost úsudku, takže v pozdějším věku už začla psát takovéhle nesmysly. Sorry, je to osobní útok na autorku, která se nemůže bránit, ale když někdo tak vehementně tvrdí něco, co sám svým tvrzením popírá, patří mu to.
Himaláje, Alpy, zemětřesení, cunami – to jsou všechno nesmysly. Autorka tomu prostě nevěří. A to přece jako důkaz stačí, ne?
Nevím, ale podle mne se o tomto zde vůbec nepíše? Ani nerozumím tomu, jak jsi to pochopil (?) :-(
Pochopil jsem to tak, že autorka vůbec neuznává teorii o tektonických deskách a jejich pohybech. Důsledky těchto pohybů, které jsou viditelné a jsou v souladu se zmíněnou teorií, jsou právě Himaláj, zemětřesení atd.
Opět vytrženo z kontextu: Autorka netvrdí, že to nikdy neviděla, ale že Tento jev však nemůže vysvětlit přesuny, které jsme citovali.
Nemůže, protože autorka si myslí, že je ten jev moc slabý. To nevadí, že tímto jevem se vysvětlují i přesuny daleko rozsáhlejší…
27.7.2006 22:36 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?

1 + 2) No, já právě běžným pozorováním docházím k závěru, že má autorka spíš pravdu (nehádám se, myslím to vážně). Viz např. vymírání druhu... už to tu nechci psát znovu.
2) Ano, je to tu zmíněno po prvé (kp. 3)
(už jsem si to přesně nepamatoval.. moje chyba, omlouvám se)
3) zde
Díky a dobrou noc :-)

28.7.2006 10:24 Filip Jirsák | skóre: 67 | blog: Fa & Bi
Rozbalit Rozbalit vše Re: Evoluce?
1 + 2) No, já právě běžným pozorováním docházím k závěru, že má autorka spíš pravdu (nehádám se, myslím to vážně). Viz např. vymírání druhu... už to tu nechci psát znovu.
A vznik nových druhů? Druhy vymírali vždycky, je to základní princip evoluce – nové věci vznikají a staré zanikají. No a pokud se opravdu všechno jen zhoršuje, a autorka se dříve hlásila k evoluci a teď ke kreacionizmu, co si z toho mám odvodit jiného, než že se dříve hlásila k tomu lepšímu a teď k tomu horšímu?

Jinak ten fenomén neustálého zhoršování jde snadno vysvětlit tím, jak funguje vnímání okolního světa lidmi – vnímáme především prudké změny, pomalý vývoj nejsme schopni zaregistrovat (jako příklad se často uvádí vhození žáby do vařící vody vs. pomalé ohřívání, ale on by pomalé ohřívání nerozpoznal ani člověk). A protože v evoluci je vznik vždy postupný po malých krůčcích, kdežto zánik je vždy naráz (např. poslední zvíře nějakého druhu žije a pak naráz nežije), zaregistrujeme spíš ty změny k horšímu. A i v případě středně rychlých změn vnímáme víc změny k horšímu. Stačí se podívat třeba jak se prokazatelně zlepšil život v ČR od roku '89, ale spousta lidí by vám začla vykládat, jak se to všechno zhoršilo.
3) zde
Tomu nerozumím…
27.7.2006 17:40 Kyosuke | skóre: 28 | blog: nalady_v_modre
Rozbalit Rozbalit vše Re: Evoluce?
Nejsem schopen vyjádřit se ke všem bodům tohoto pamfletu, ale ty body, které se zabývají věcmi, o kterých mám jakési povědomí, jsou jen snůšky polopravd, zamlčených nových objevů a ignorance. Nevím, jestli má cenu začít si zjišťovat objektivní informace o těch dalších... :-D
27.7.2006 17:44 Michal Vyskočil | skóre: 60 | blog: miblog | Praha
Rozbalit Rozbalit vše Re: Evoluce?
Hezká patička ... Pavel Tišnovský mi poslal nějaké materiály o Lispu, tak jsem zvědav, co to udělá se mnou :-)
When your hammer is C++, everything begins to look like a thumb.
Marek Bernát avatar 27.7.2006 21:10 Marek Bernát | skóre: 17 | blog: Arcadia
Rozbalit Rozbalit vše Re: Evoluce?
Forth a Lisp majú niečo spoločné? (otázka zo záujmu -- o Forthe nič neviem).

Inak, pätička je naozaj skvelá (hoci stále neviem, čo ten Forth je :-) )
physics.stackexchange.com -- Q&A stránky o fyzike v štýle StackOverflow.
Marek Bernát avatar 27.7.2006 21:33 Marek Bernát | skóre: 17 | blog: Arcadia
Rozbalit Rozbalit vše Re: Evoluce?
Wow, jazyk s reverznou poľskou notáciou; paráda, asi sa na to pozriem časom.
physics.stackexchange.com -- Q&A stránky o fyzike v štýle StackOverflow.
27.7.2006 21:48 Kyosuke | skóre: 28 | blog: nalady_v_modre
Rozbalit Rozbalit vše Re: Evoluce?
Forth, Lisp a Smalltalk jsou tři naprosto rozdílné programovací jazyky, které mají strašně moc podobných rysů... :-D

Viz http://www.cfcl.com/~eryk/weblog/archives/000129.html. ;-)
Marek Bernát avatar 27.7.2006 22:29 Marek Bernát | skóre: 17 | blog: Arcadia
Rozbalit Rozbalit vše Re: Evoluce?
Smalltalku som sa venoval už dávnejšie a som rozhodnutý sa k nemu zasa vrátiť, keď bude čas. A Lisp sa práve učím a momentálne som ním absolútne uchvátený. A jeden čas som sa intenzívne venoval dc, takže som si vypestoval aj závislosť na postfixovej notácii :-)

Dík za linku, linky mám rád :-)
physics.stackexchange.com -- Q&A stránky o fyzike v štýle StackOverflow.
27.7.2006 22:36 Kyosuke | skóre: 28 | blog: nalady_v_modre
Rozbalit Rozbalit vše Re: Evoluce?
Já se těším, až si pořídím HP-49G+. Je to jediná kalkulačka s 75MHz ARMem, kterou znám, a programuje se (jako ostatní HPčka) v jazyku Reverse Polish Lisp. Nezní to slibně? :-D

To já jen k tomu, jak se mě někdo snažil tady přesvědčit, že Teksas Inštrumenty a Kasijo dělají lepší... ;-)
Marek Bernát avatar 28.7.2006 13:58 Marek Bernát | skóre: 17 | blog: Arcadia
Rozbalit Rozbalit vše Re: Evoluce?
Ja sa tiež v poslednej dobe ohliadam po nejakom PDA/smartphone, na ktorom by sa dalo robiť všeličo netradičné a užitočné a to všetko za rozumnú cenu. Zatiaľ som však nič také nenašiel. Na to HP sa pozriem, možno to bude niečo, čo hľadám. :-)
physics.stackexchange.com -- Q&A stránky o fyzike v štýle StackOverflow.
Marek Bernát avatar 28.7.2006 15:02 Marek Bernát | skóre: 17 | blog: Arcadia
Rozbalit Rozbalit vše Re: Evoluce?
Tak už som rozhodnutý, to HP chcem. Nevieš, či sa dá zohnať aj niekde v okolí (Česko, Slovensko)?
physics.stackexchange.com -- Q&A stránky o fyzike v štýle StackOverflow.
Marek Bernát avatar 28.7.2006 15:33 Marek Bernát | skóre: 17 | blog: Arcadia
Rozbalit Rozbalit vše Re: Evoluce?
Odpoviem si sám, dá sa :-)

Ale zistil som, že existuje aj 50g, celkom nová, stojí zhruba tak isto a opravuje niektoré problémy 49g (hlavne na klávesnicu sa ľudia sťažovali).
physics.stackexchange.com -- Q&A stránky o fyzike v štýle StackOverflow.
27.7.2006 09:25 klassik | skóre: 24 | blog: Klassikov | Praha
Rozbalit Rozbalit vše Re: Evoluce?
Nejsem verici a mozna ze to nekdo v prispevku uz psal ale nejak sem se toho nedocetl. Jak si krestane predstavuji vznik zivota popripade vznik lidi? To ze to tu stvoril buh me pride mnohem absurdnejsi nez teorie pana darwina. respektive Darwinova teorie ac pres nektere otazky je docela slibna.Nerikam ze to tak bylo ale rozhodne je pravdepodobnejsi nez sazet na boha.
V podstatě nic nevím
27.7.2006 09:31 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
Mně se to jeví přesně opačně ;-)
27.7.2006 09:43 klassik | skóre: 24 | blog: Klassikov | Praha
Rozbalit Rozbalit vše Re: Evoluce?
No o darwinove teorii neco vim ale to ktere veris ty nic.Naznac o cem to je
V podstatě nic nevím
27.7.2006 10:02 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
My nesmíme ani naznačovat... :-D No, mrkni se třeba na tu knížku Jablko sváru. Není moc tlustá a pro mne to bylo docela zajímavý čtení. Minimálně jsem díky ní začal přemýšlet o tom, že v té evoluční teorii asi není všechno tak jasné, jak se tvrdí.. :)
27.7.2006 10:08 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce?
Označil si to za podobnou knihu jako to ,dílo` co tu dává autor blogu ke stažení. Doufám, že ta podobnost měla být jenom určitou spojitostí v námětu nebo něčem takovém, protože jestli to má s tím Kábrtovým zoufalstvím podobnou třeba i kvalitu, tak to fakt ne.
Copak toho není dost?
27.7.2006 10:12 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
Tu knihu nenapsal Kábrt a já jsem ji četl mnohem dřív (on ji snad jen přeložil).
27.7.2006 10:13 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce?
To s ním má taky co do činění? Aha.
Copak toho není dost?
27.7.2006 10:20 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
Napsala to Dr. Sylvie Bakerová. Můžeš si to přečíst v originále :)
kyknos avatar 28.7.2006 15:38 kyknos | skóre: 18 | blog: Quid novi? | Ranša Rosa
Rozbalit Rozbalit vše Re: Evoluce?
Tyhle knihy jsou založeny na tom, že předloží domělé díry v evoluční teorii a otázky, které laik nedokáže zodpovědět, a pak do něj nenápadně hustí kreacionistické bláboly. V lepším případě uvádí zcela nesmyslná "fakta" a lži, v lepším věci pro laika zdánlivě paradoxní, ale jinak snadno vysvětlitelné.
So the Nationalists and the Socialists have the same policy on Brexit. They should get together and form a...
elviin avatar 27.7.2006 09:36 elviin | skóre: 29 | blog: elviin | Plzeň-Praha
Rozbalit Rozbalit vše Re: Evoluce?
Ja jsem pristupnej cemukoliv, co respektuje logiku meho vesmiru:)

Ale nejak mam pocit, ze kreacioniste nemaji iniciativu, proste jen vyvraci mezery ve vede, ktere jsou transparetni a nikdo nepopira, ze je tam prostor pro dalsi vedecky vyzkum. Naopak kreacioniste svoje konstrukce povazuji za neomylne (bez mezer) a opiraji se jen o ty mezery ve vede.

Ale co je spravne, vzdycky pochybovat.
27.7.2006 09:31 Sinuhet | skóre: 31
Rozbalit Rozbalit vše Re: Evoluce?
Chcete odpovedi? Na internetu si projdete Talk Origins. A v knihkupectvi se poohlednete po Jak se dela Evoluce.
elviin avatar 27.7.2006 09:32 elviin | skóre: 29 | blog: elviin | Plzeň-Praha
Rozbalit Rozbalit vše Re: Evoluce?
S tou entropii jsem cetl, ze zivot nejde proti entropii. Aby se zachovala informace v cloveku, tak zkonzumuje/vyprodukuje tolik tepla, ze celkove entropie roste. To samy s pocitacem, kde entropie take roste vzhledem k vydane energii nutne k udrzeni informace.

Pripomelo mi to i teorii pisku, ktery ma schopnost replikace. Ostatni zrnicka kopiruji polohu podle toho puvodniho (ale nemusi), ale ne kvuli tomu, ze by chteli uchovat nejakou informaci, ale proste je to energeticky vyhodnejsi.

Ja bych rekl, ze s zivotem je to jako s bublinama. Kdyby nekdo prokazal, ze zivot dokaze vytvaret a udrzovat mene energeticky narocny stavy (tak jako propojovani bublin), tak by to pak zapadalo.
elviin avatar 27.7.2006 09:47 elviin | skóre: 29 | blog: elviin | Plzeň-Praha
Rozbalit Rozbalit vše Re: Evoluce?
Jeste mne neco napadlo. Kdyz chci utracet mene penez, usetrit na najmu, tak je dobry si sehnat nejakho spolubydlice. To samy plati o rodine, firmach a jakekoliv lidske skupine. Proste usetrit penize - energii. A penize jsou vlastne obraz lidskych potreb.

Tak jako to dela pisek, atomy nebo bubliny, aby se dostali do mene narocneho energetickeho stavu, nedela nahodou to samy clovek, akorat k tomu pouzivat slozitejsi a komplikovanejsi fyzikalni nastroje, profiltrovane a propracovane evoluci? Proc by proste nemohl zivot vzniknout nahodou? Hodne let x hodne prostoru dava velke sance, kdo vi jake byly podminky.

Rikam, jsem otevreny cemukoliv a nemam v tomto vubec vzdelani, ale premyslet o tom je zajimavy.
27.7.2006 09:53 klassik | skóre: 24 | blog: Klassikov | Praha
Rozbalit Rozbalit vše Re: Evoluce?
on nekdo tvrdi ze zivot nevzniknul?
V podstatě nic nevím
elviin avatar 27.7.2006 10:00 elviin | skóre: 29 | blog: elviin | Plzeň-Praha
Rozbalit Rozbalit vše Re: Evoluce?
.. nahodou
27.7.2006 10:04 klassik | skóre: 24 | blog: Klassikov | Praha
Rozbalit Rozbalit vše Re: Evoluce?
Jako ze nevznikl nahodou?to me prijde vcelku jasny ze to byla shoda okolnosti
V podstatě nic nevím
27.7.2006 10:08 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
... náhodou? Jakoby vlastně mimochodem... nebo spíš jakoby omylem? (To určitě!) :-D
27.7.2006 10:11 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce?
Dneska jsem zauvažoval jakým způsobem jsem se dostal k mnoha věcem, které na mne mají značný vliv. Můžu to brát jako nesmyslné náhody, které jsou pravděpodobné asi jako že zítra spadne Měsíc. A nebo taky jako promyšlené a předem naplánované dílo. Hm, to druhé mi nesedí.
Copak toho není dost?
27.7.2006 10:13 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
No vidíš, mně to připadá obráceně. Ve všem je příliš mnoho logiky, než aby se to vše stalo a vyvinulo náhodou...:-)
27.7.2006 10:14 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce?
Ne, to je jenom dostatečně chaoticky poskládaný chaos. Nic víc :-)
Copak toho není dost?
27.7.2006 10:17 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
Nedhádám se, jen píšu, že mně to připadá přesně obráceně - tj. vše je velmi logické (...a také krásné) ;-)
27.7.2006 10:15 klassik | skóre: 24 | blog: Klassikov | Praha
Rozbalit Rozbalit vše Re: Evoluce?
Takze kniha osudu to bude to cemu veris?
V podstatě nic nevím
27.7.2006 10:17 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
Co je kniha osudu?
27.7.2006 10:20 klassik | skóre: 24 | blog: Klassikov | Praha
Rozbalit Rozbalit vše Re: Evoluce?
tusim ze v to veri arabove. Nebo tyhle lidi spojeny s alahem.Veri ze je nejaka kniha osudu kde je napsan osud kazdeho cloveka.Co udela co rekne co se bude dit. Prislo mi ze kdyz si psal ze veris tomu ze je vse nalajnovany tak by to mohlo byt prirovnano ke knize osudu.
V podstatě nic nevím
27.7.2006 10:22 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
Aha, tak to jsem se asi špatně vyjádřil... Ne ne, žádná kniha osudu.
Daniel Kvasnička ml. avatar 27.7.2006 10:09 Daniel Kvasnička ml. | skóre: 52 | blog: The Joys and Sorrows of Being an IT Freak | Ostrava
Rozbalit Rozbalit vše Re: Evoluce?
Naprosto me fascinuje, jak jste si tu vsich 100% jisti tim, co mate v hlave. Kdyz jsem tu knihu cetl, taky me napadlo, ze jestli chtel Kabrt diskutovat, mel zvolit jiny ton, ale to, co tady pisete, svedci podle meho jen o jednom - nikdo z vas (zatim?) necetl ty kapitoly podrobne. Kdybyste se prekonali a cetli to, mozna byste se divili, kolik veci tam je proste jen faktu a vedeckych veci, on ten pan je mozna agresivni, ale v dost vecech se vyzna.

Je to o tom, co nikdo z vas nerekne nahlas. Bojite se, ze kdybyste ty tuny stran textu cetli, nasli byste tam "vetsi nez male mnozstvi" dat, ktera by ucinne podkopala vase presvedceni - a to se vam nechce, protoze mate radi pohodli sve 100% presvedcenosti. Blby pocit, ze? ;-)

A nakonec jeste pripomenu, ze tu nejsem za nejakeho extremniho kreacionistu - jak jsem psal.
FSF: “screw you for not wanting the stuff we produce”, People: “screw you for not producing the stuff we want."
27.7.2006 10:11 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce?
Tam žádná fakta nejsou! Minimálně v kapitole dvě a tři nejsou vůbec žádné. Nenašel jsem je.
Copak toho není dost?
Kazda z tech kapitol ma 3 casti, to v obsahu, pak ten uvod a pak ta kapitola samotna - v ni je dost smysluplnych vedeckych zalezitosti a v nekterych (zrejme v tech, na ktere jsi uz nemel silu) i fakta.
FSF: “screw you for not wanting the stuff we produce”, People: “screw you for not producing the stuff we want."
27.7.2006 10:18 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce?
Ne, nenašel jsem je, ukaž mi nějaký.
Copak toho není dost?
Ta dosti podrobna data o archeologickych nalezech ti nestaci? A navic nechapu, ceho se tim snazis dosahnout. Jako ze evolucionismus stavi na faktech a kreacionismus na teoriich? :-)
FSF: “screw you for not wanting the stuff we produce”, People: “screw you for not producing the stuff we want."
27.7.2006 10:34 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce?
Hovoříš o čtvrtém omylu? Kde jsou tam ta fakta? Kábrt mluví o tom, že se nenašlo odpovídající milióny kostí nebo jiných zbytků. Ještě by pan Kábrt mohl uvést aspoň hrubou statistiku kolik se těch zbytků asi tak nachází. Co vím, tak jedna aspoň trochu kompletní kus kosti, pořádají se obrovské oslavy. Pan Kábrt by se mohl zamyslet. Kopal třeba někdy na zahrádce základy pro nějakou zeď? Proč tam ty miliardy kostí nenašel sám?
Copak toho není dost?
Tak podivej, fakta v te knize jsou. Tvrzeni, ze tam zadna nejsou, je proste nesmyslne - vzdyt si to cetl. Treba nalez zive Latimerie. To je fakt. Jen priklad.

Potom, tech argumentu je tam mnohem vice. Ty mi tady neco napises a myslis si, ze ja z toho sednu na prdel?
FSF: “screw you for not wanting the stuff we produce”, People: “screw you for not producing the stuff we want."
27.7.2006 10:48 klassik | skóre: 24 | blog: Klassikov | Praha
Rozbalit Rozbalit vše Re: Evoluce?
moment moment. Ty ty blaboly fakt beres vazne?
V podstatě nic nevím
Latimerie se nenasla?
FSF: “screw you for not wanting the stuff we produce”, People: “screw you for not producing the stuff we want."
27.7.2006 11:04 klassik | skóre: 24 | blog: Klassikov | Praha
Rozbalit Rozbalit vše Re: Evoluce?
Aha tak to me staci. konec diskuze si dobry demagog pokud to beres seriozne. Mno jdu se zapojit do jine diskuze
V podstatě nic nevím
Chces se dostat na prvni misto v soutezi o nejzabednenejsiho evolucionistu, ze? :-) Tak co treba toto.
FSF: “screw you for not wanting the stuff we produce”, People: “screw you for not producing the stuff we want."
27.7.2006 11:15 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce?
Co je na Latimerii tak úžasně ničivého a drtivého, že to evoluce nesnese? Evoluce je plná omylů, kuriozit a nesmyslů. Latimerie je ještě v normě.
Copak toho není dost?
27.7.2006 11:28 Kníže Ignor | skóre: 19 | blog: stoupa
Rozbalit Rozbalit vše Re: Evoluce?
Ale von ti jenom vyvrací, že v té knize nejsou žádná fakta. A latimerie se našla, to je fakt :-D :-)
Jestli máš zálohu mého blogu, tak mi ji pošli. Nějak jsem si ho smazal :-)
27.7.2006 11:30 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce?
No, dobrá, to je pravda. Já už svoji chybu uznal. Fakta se našla, i když v počtu ne tak hojném. Vím o dvou :-)
Copak toho není dost?
27.7.2006 12:26 klassik | skóre: 24 | blog: Klassikov | Praha
Rozbalit Rozbalit vše Re: Evoluce?
Ja do toho nedelam sem pro evoluci ale necham si ji v klidu vyvratit nejakym jinym faktem nebo teorii.Zatim si tu zabednenej bohuzel jen ty
V podstatě nic nevím
27.7.2006 11:00 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce?
Promiň. Přečetl jsem si dohromady pět, slovy pět ,omylů`. Byly to blbosti a fakta v nich nebyla. Byly to maximálně spekulace. Skoro mi přijde, že to psal stejnou metodou, jako kdyby z vět ,,Pravěcí lidé vznikli z opic. Dále jejich vývoj probíhal…`` usoudil, že pravěcí lidé se nevyvíjeli, protože vznikli z opic a ta druhá věta už přeci není o nich, protože to tam není výslovně napsáno a hnusná ateistická věda to nechce uznat. Asi tak mi přijdou vědecké metody pana Kábrta.

Mimochodem, čistě ze zvědavosti jsem přečetl kapitolu o homosexualitě. Fakt který pan Kábrt uvádí a já s ním souhlasím je, že je to úchylka. Tím ovšem tak nějak končí všechno co v té kapitole můžu číst bez pošklebků, protože dál už si bájí svoje pohádky. Dobrá, minimálně jeden fakt tam je. Ovšem k ničemu, protože se z něho vyvozují nesmyslné závěry.
Copak toho není dost?
Tím ovšem tak nějak končí všechno co v té kapitole můžu číst bez pošklebků
No, tys mi za poslednich par dnu uz dokazal, ze bez posklebku nejsi schopen prakticky niceho, takze asi poprve v zivote vyzkousim to blokovani, kdyz uz to Leos implementoval.
FSF: “screw you for not wanting the stuff we produce”, People: “screw you for not producing the stuff we want."
27.7.2006 11:14 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce?
Přiznám se ti k jedné věci. Až do minulého týdne jsem tě blokoval prakticky od chvíle co ta funkce je. Odblokoval jsem tě proto, že jsem zjistil, že na některá témata se s tebou bavit dá (ach, jak je všechno relativní). Proč jsem tě blokoval prve? Kvůli tvým zprávičkám, k některým věcem se občas dostanu dříve než tady ve zprávičce a někdy člověk žasne, jak to funguje. Nevím, jestli to bylo tvoji vinou, nicméně tupá novinařina mě poslední dobou štve víc než třeba i křesťani.
Copak toho není dost?
27.7.2006 11:17 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce?
Je ovšem pravda, že bavit se s trollem, co není schopen tuto myšlenku přijmout a fanaticky tvrdí naučený nesmysl (totiž že je člověk), to nemá cenu :-) Kdyby aspoň připustil, že teorie jeho člověčenství má své díry.
Copak toho není dost?
27.7.2006 14:43 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce?
Mimochodem, nejsem věděcká kapacita ani vůbec vědec, nějak si ani extra nezakládám na tom, že bych byl nejchytřejší na světě a vůbec věřím, že jsem celkem skromný. Nicméně když někdo čte něco takového jako ona Kábrtova kniha, kdovíjak to žere a pak mi řekne, že z mých řečí si nebude sedat na prdel, to už nemá daleko k tomu mě urazit.
Copak toho není dost?
27.7.2006 10:17 klassik | skóre: 24 | blog: Klassikov | Praha
Rozbalit Rozbalit vše Re: Evoluce?
No hlavni je ze tam toho mas dost ty:-)
V podstatě nic nevím
hajma avatar 27.7.2006 10:17 hajma | skóre: 27 | blog: hajma | Říčany
Rozbalit Rozbalit vše Re: Evoluce?
Bojite se, ze kdybyste ty tuny stran textu cetli, nasli byste tam "vetsi nez male mnozstvi" dat
Přesně tak, bojím se, že kdybych to četl, zbytečně bych zabil čas, který můžu strávit děláním něčeho užitečnějšího :-)

<insult>Ty snad čteš každou kravinu?</insult>
21 promarněných znaků
27.7.2006 10:28 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce?
Mimochodem, fascinuje mě, jak mi tak sebejistě podsouváš, že bychom měli nad evolucí kdovíjak pochybovat či co. To je práce pro biology, fyziky, chemiky, možná někoho navíc. Oni se snaží zjistit potřebné detaily. Mně jsou prezentováný velmi smysluplné závěry, podpořené vlastním pozorováním.

Oproti tomu je mi ukazována (urážlivou, agresivní formou) jiná představa, která je pro mne sama o sobě nelogická, nenašel jsem žádnou oporu ve skutečném světě a ani žádný problém ve skutečnosti neřeší. Když se touto představou nehodlám zabývat (kvůli výše uvedeným nedostatkům), jsem označen za fanatika co ho nezajímá nic než nějaký nesmysl co mu kdosi napumpoval do hlavy. Pánové, já nejsem povinen zabývat se každou kravinou co kdo dokáže vypotit a co je hlavní, rozhodně kvůli tomu nejsem povinen přečíst bichle napsané lidmi (bylo sprosté slovo, pak jsem se uklidnil) jako Kábrt.

Až přijdete s ucelenou, vědeckou představou jak má takový kreacionismus vypadat, můžu se na to podívat (ačkoliv mě tyhle věci nezajímají).

Když ti budu tvrdit, že nejsi člověk, ale jeskynní troll a budu ti doporučovat, ať si přečteš dvacetisvazkový spis, kde je to objasněno (ten samozřejmě musíš přečíst dost pozorně), předpokládám, že uznáš možnost že mám pravdu, připustíš moje tvrzení a poslušně se tím začneš zabývat.
Copak toho není dost?
27.7.2006 10:13 ajikdpoe | skóre: 23 | blog: dvh
Rozbalit Rozbalit vše Re: Evoluce?
Hmm... ono to pekne vyzera ked sa povie "bola neziva hmota a zrazu z nej vznikla ziva hmota" a potom (kreacionisti) hovoria ze je to blbost a ze tam musela byt nejaka vyssia entita. Ale...

V knihe "Zivot" (ceska, cca rok 1989) je tato veta "bola neziva hmota a zrazu z nej vznikla ziva hmota" rozpisana velmi velmi podrobne na cca prvych 150 stranach (a za tych 17 rokov sa ludstvo urcite dozvedelo ovela viacej takze uz vieme urcite viac). Kazdopadne kreacionistom odporucam si tych 150 stran precitat nech vedia ze mi darvinisti netvrdime ze "bola neziva hmota a zrazu z nej vznikla ziva hmota" ale ze to bol neuveritelne komplikovany ale pochopitelny a vedeckymi experimentami opakovatelny proces. A ako vieme, opakovatelny experiment je zakladny kamen vedy.

Som darvinista telom aj dusou, a samozrejme ateista. V tej knihe je to dostatocne dobre a kvalitne popisane na to aby som s mojimi vedomostami pripustil ze nikde v zmienenom procese obzivnutia mrtvej hmoty niet miesto pre boha lebo ho tam jednoducho nieje treba. Staci par jednoduchych sil ako elektromagnetizmus a gravitacia a je to. Ak nebudete sprtat do vnutra atomov (pri studiu reakcii ATP a kyseliny fosforecnej vam to netreba) tak tam vam slabu a silnu interakciu ani netreba.
neuveritelne komplikovany ale pochopitelny a vedeckymi experimentami opakovatelny proces.
Rad bych ziskal nejake informace o pokusech, ktermi ten proces byl zopakovan.
FSF: “screw you for not wanting the stuff we produce”, People: “screw you for not producing the stuff we want."
27.7.2006 10:21 klassik | skóre: 24 | blog: Klassikov | Praha
Rozbalit Rozbalit vše Re: Evoluce?
nebud nedockavej. Spousta pokusu se povadla az po dost dlouhe dobe.Vetsinou je nejdriv teorie a pak teprv praxe
V podstatě nic nevím
Kdyz nasvu nejaky proces opakovatelny, pak to delam proto, ze jsem dokazal, ze opakovatelny je tim, ze jsem ho zopakoval.
FSF: “screw you for not wanting the stuff we produce”, People: “screw you for not producing the stuff we want."
27.7.2006 10:30 klassik | skóre: 24 | blog: Klassikov | Praha
Rozbalit Rozbalit vše Re: Evoluce?
Vcera jsem si precetl velmi zajimavy clanek na idnes. Taky bylo neco vypocitano a za x let se to mozna povede dokazat.Treba ne a bude to trvat dele. Rozumim tomu dobre, ze si myslite ze kazda teorie musi byt vzapeti i dokazana? Odkas co jste uvedl jsem si precetl jen k "druhemu omylu"Ktery me naznacil ze to bude dobra slatanina. Pride mi uplne stejne tvrzeni ze jen naivni clovek si mylsi z ezivot vznikl mavnutim proutku. Asi sou na zemi vsici lide naivni a jen pan spisovatel je v obraze
V podstatě nic nevím
Nemyslim, ale kolega pouzil termin opakovatelny. Ja jen rikam, ze se tento termin ma pouzivat spravne. Kdyz to nebylo dokazano, tak at pouziva jine terminy.

Mluvite stejne jako vsichni ostatni. Absolutne nesmyslne implicitne predpokladate nemoznost existence formy inteligence pri stvoreni sveta.
FSF: “screw you for not wanting the stuff we produce”, People: “screw you for not producing the stuff we want."
27.7.2006 10:36 klassik | skóre: 24 | blog: Klassikov | Praha
Rozbalit Rozbalit vše Re: Evoluce?
odkud se vzala ta inteligence?
V podstatě nic nevím
27.7.2006 10:37 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce?
Tohle by mě zajímalo, jak kreacionismus řeší problém vlastní kreace :-) (hlásím se kdyžtak k jeho případné kremaci)
Copak toho není dost?
27.7.2006 10:40 klassik | skóre: 24 | blog: Klassikov | Praha
Rozbalit Rozbalit vše Re: Evoluce?
nebranim se tomu ze neco mohla stvorit inteligence vyssiho sveta ale kdo zas stvoril tu inteligenci... Darwin vysvetlil vznik teorie ale ty teorie pana Kvasnicky me vznik jeste neobjasnily. Mozna je nekdo objasnil jen o tom nevim
V podstatě nic nevím
27.7.2006 12:52 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce?
Stejně nesmyslně bychom ale předpokládali i existenci inteligence.
Copak toho není dost?
btw: ceska kniha o tomhle z r. 1989? :-D Druhy extrem, ze? To si myslite, ze svuj nazor zformuju podle knihy, na jejiz tvorbu meli vliv lide vyznavajici ideologii, ktera ateismus a darwinismus absolutisticky prosazovala bez ohledu na jakekoliv jeji rozpory? Ne, to opravdu ne. Stejne tak jako si svuj nazor nevytvorim pouze podle Kabrtovy knihy.
FSF: “screw you for not wanting the stuff we produce”, People: “screw you for not producing the stuff we want."
27.7.2006 10:32 klassik | skóre: 24 | blog: Klassikov | Praha
Rozbalit Rozbalit vše Re: Evoluce?
Na krestany nema vliv ideologie?
V podstatě nic nevím
Stejne tak jako si svuj nazor nevytvorim pouze podle Kabrtovy knihy.
Asi sis po ranu jeste nepromnul oci, ze? :-)
FSF: “screw you for not wanting the stuff we produce”, People: “screw you for not producing the stuff we want."
27.7.2006 10:37 klassik | skóre: 24 | blog: Klassikov | Praha
Rozbalit Rozbalit vše Re: Evoluce?
Omyl č.7 to je taky pekna konina...
V podstatě nic nevím
27.7.2006 11:50 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce?
Spíš doporučuji si podrobně přečíst 20, 9, 10 nebo 11. To je teprve ten správný nářez…
27.7.2006 10:38 klassik | skóre: 24 | blog: Klassikov | Praha
Rozbalit Rozbalit vše Re: Evoluce?
No projevujes se tu jako ukazkovy radikalni extremista:-)
V podstatě nic nevím
27.7.2006 10:43 Filip Jirsák | skóre: 67 | blog: Fa & Bi
Rozbalit Rozbalit vše Re: Evoluce?
Škoda že Pavel Kábrt zapomněl na některé další omyly. Např. že Země je kulatá. Představovla bych si to asi takhle:
Omyl 34.

Mnozí dnes věří, že Země je kulatá. Ve skutečnosti v žádném případě kulatá být nemůže. To tvrdí dnes už tisíce vědců a lze to dokázat jak naší zkušeností (tj. prostým životním pozorováním), tak i ověřenými přírodními zákonitostmi (v laboratoři) a řadou nálezů (v terénu). Potíž není ve vědě, ale v neochotě mnoha vědců i médií uznat, kterým směrem důkazy ukazují.

Na úvod si učiňme malý myšlenkový pokus: Představte si, že bychom na vršek míče položili kuličku. Kulička se tam samozřejmě neudrží, okamžitě sklouzne dolů. A teď učiníme stejný pokus i se Zemí. Na její domnělý vršek (na pól) položíme míč. Pokud by Země byla kulatá, musel by okamžitě sklouznout dolů. Ale viděli jste snad, že by kolem vás prolétaly míče z pólů? Ověřit to můžeme snadno i u nás: na kdejakém venkovském hřišti hrají kluci fotbálek – všimli jste si snad někdy, že by jim míč utíkal a někam padal? Země a koule? Jen v bujné fantazii lidí. Proč ani v náznaku nepozorujeme nějakou kulatost Země?! Řeknu vám to: Protože celá teorie o kulatosti Země je jen jedna velká pseudovědecká lež a moderní ateistické náboženství.
Atd. atd. Jestli v tom textu někde opravdu je něco o tom, jak se při jeho čtení nezbláznit, mělo by to být hned na začátku, kdekoli dál už je to pozdě…
elviin avatar 27.7.2006 10:55 elviin | skóre: 29 | blog: elviin | Plzeň-Praha
Rozbalit Rozbalit vše Re: Evoluce?
peknej priklad
27.7.2006 11:00 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
Je to vtipný i pochopitelný. Mně ale vadí, že se to posouvá do osobní roviny místo věcné argumentace. Takový přístup škodí jedné i druhé straně. :-(
27.7.2006 11:23 Sinuhet | skóre: 31
Rozbalit Rozbalit vše Re: Evoluce?
27.7.2006 11:35 Robert Krátký | skóre: 94 | blog: Robertův bloček
Rozbalit Rozbalit vše Re: Evoluce?
Uff, nečetl jsem komplet, jen výtažky na začátku, ale i to mi stačí k hodnocení. Až na číslo 7 (komunismus - i když rétorika je komická) je to neuvěřitelná snůška demagogických blábolů. Pan Kábrt zneužívá všeobecné nevědomosti a dosti primitivních pudů (závist, zlost, ...) k neobyčejně absurdním logickým přemetům.
Muzes v kratkosti napsat, co ti pripadne demagogickeho v kapitolach 2 4 a 5 napriklad? Zcela uprimna otazka.
FSF: “screw you for not wanting the stuff we produce”, People: “screw you for not producing the stuff we want."
27.7.2006 13:38 Robert Krátký | skóre: 94 | blog: Robertův bloček
Rozbalit Rozbalit vše Re: Evoluce?
Omezím se na úvodní odstavečky.
2: Jen zcela naivní člověk věří, že hmota v minulosti sama ožila
Život je jen ze živého a víra v dávné sebeoživení mrtvého materiálu není vědou, ale jen zoufalým náhradním náboženstvím zmatených ateistů.
Jednoznačné tvrzení (Život je jen ze živého) nepodpírá argumenty, nýbrž odsuzuje ty, kteří s ním nesouhlasí, na základě hanlivého popisu oponenta. Typický nástroj demagogů: vyřkneš tvrzení (hmota v minulosti sama ožila) a odsoudíš ho nikoliv na základě argumentace, ale pomocí směsice smyšlených, leč zvučných obvinění jeho údajných zastánců.
4: Člověk je příbuzný s opicí asi jako stolička s jezevčíkem
Bakterie, bezobratlí, houby, ryby, obojživelníci, plazi, ptáci, savci i člověk jsou stále, po všechny věky stejní. Nulová evoluce ve zkamenělinách dosahuje svého maxima ve fantazii těch, kteří v ni věří, a zločinně vyučují tyto svoje pohádky bezbranné studenty na školách i veřejnost.
Začíná tvrzením o tom, že všechny druhy jsou pořád stejné. To je snadno deklarovatelné, ale také snadno vyvratitelné. Kdyby nedocházelo ke změnám, neměli bychom dnes např. takový chléb, na jaký jsme zvyklí. Příkladů jsou spousty, ale on je svým tvrzením smetává pod stůl. "Nulová evoluce ve zkamenělinách" je obratně demagogicky podpořena nikoliv argumentací, ale opět hanobením odpůrců takového tvrzení. Místo jediného argumentu pokračuje řečmi o zločinném vyučování. Místo aby předkládal důkazy, útočí na emoce. Důkazy totiž předložit nejde. Naopak jde však mimo vší pochybnost ukázat na množství důkazů, které hovoří pro - evoluce ve zkamenělinách samozřejmě k nalezení je.
5: Charles Darwin byl pohádkář a rasista, ne velký přírodovědec
Omyly a nesmysly Charlese Darwina, na kterých postavil svoje fantazie o přeměnách jedné skupiny zvířat v jinou, mají nedozírně tragické důsledky. Že byl rasista, to se dnes samozřejmě tají stejně obratně jako i jiné hlouposti, které tento „velký vědec“ zplodil, a které se úspěšně ujaly ve světě zmatených a hlavně bezbožných lidí.
Darwina označuje za rasistu, ale až v samotném textu se dovídáme, že je to pouze proto, že jeho teorii zneužili ve svůj prospěch skuteční rasisté. Asi jako tvrdit, že Nobel byl válečný zločinec. Demagogie spočívá v tom, že na základě důsledků nějakého činu (zveřejnění evoluční teorie), obviňuje její autory ze spoluviny. Samozřejmě, že ta teorie má tragické důsledky - stejně jako jakákoliv jiná zneužitá teorie, kterou ve svém šílenství cituje nějaký zločinec. Obvinil by křesťanství z násilnictví proto, že spoustě lidem vnuklo pomatené myšlenky o tom, jak je třeba upalovat čarodějnice? Je to prostě opět typická demagogie.
27.7.2006 13:47 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce?
Darwina označuje za rasistu, ale až v samotném textu se dovídáme, že je to pouze proto, že jeho teorii zneužili ve svůj prospěch skuteční rasisté. Asi jako tvrdit, že Nobel byl válečný zločinec.

Navíc obvinění z rasismu ze strany někoho, kdo sám předvádí tak obrovskou míru intolerance a xenofobie jako pan Kábrt, působí poněkud směšně…

Je to skoda, ze Kabrt pise takhle. Kdyby psal jinak, treba by jsi cetl dal.

To ze zivot je jen ze ziveho argumenty podpira podle meho v tom dalsim textu. Mluvilo se tu o tom uz v jinych vlaknech.

Clovek, ktery ma naturu na to to cist a filtrovat zajimave veci se dost dozvi. Je nepopiratelne, ze evolucni vedci proste selektivne vyrazuji to, co se jim do teorie nehodi. A kdykoliv se nekdo jen ozve, ze tohle vubec nedava smysl, ma nalepku nabozenskeho fanatika.

Opravdu by me zajimal nazor cloveka, ktery by si to cele precetl a pak komentoval KONKRETNI vedecke zalezitosti, o kterych se tam mluvi. Ale je mi jasne, ze cist to neni priorita vetsiny lidi tady.
FSF: “screw you for not wanting the stuff we produce”, People: “screw you for not producing the stuff we want."
27.7.2006 14:12 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce?
Tahle víra, že tam dál to je, že když si to přečtu celé, že když to budu číst dost pozorně, že když to zkusím pochopit, nebo třeba až když přistoupím na tu demagogii? Každopádně přesně tohle se mi snaží cpát tolik lidí. Napadá mě třeba Däniken, to je navlas to samé. Vykombinovat co nejvíce rádoby důkazů, hodit mi to na hlavu a tohle všechno přečti, na tohle všechno si najdi čas abys to mohl vyvrátit. Zedničina. Nevyvrátíš? Jsi fanatik a nechceš připustit můj názor! Rozdíl je v tom, že Däniken je ve svých teoriích a knihách aspoň přiměřeně slušný.

Těžko vyvrátíme, že nějací vědci něco zatajují nebo tak. Začni tím, že z Kábrta vybereš jeden úplný důkaz a tady nám ho předvedeš. Na ,čti dál, tam to je` si odmítám hrát. Jeden konkrétní důkaz.
Copak toho není dost?
27.7.2006 14:18 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce?
Myslel jsem si, že jsem to četl dost pozorně a viděl jsem jako zdůvodnění pouze:
  • protože to tak prostě je
  • protože tu přeměnu nikdo neviděl
  • tady máte zkumavku a předveďte mi to

Ani jedno mne nepřesvědčuje. Co jsem přehlédl?

Je nepopiratelne, ze evolucni vedci proste selektivne vyrazuji to, co se jim do teorie nehodi.

Pak Kábrt ovšem dělá totéž v míře, proti které ti evoluční vědci vypadají jako břídilové druhé kategorie.

27.7.2006 14:22 Filip Jirsák | skóre: 67 | blog: Fa & Bi
Rozbalit Rozbalit vše Re: Evoluce?
Clovek, ktery ma naturu na to to cist a filtrovat zajimave veci se dost dozvi.
To tedy nevím. Když v jednom textu najdu spoustu chyb, lží a výmyslů (což vše vypadá zajímavě), považovat zbytek zajímavých věcí za něco, co bych se měl dozvědět, je poněkud zvláštní, ne? Vědět, že o věcech, které si můžu ověřit, autor lže, ale o zbytku předpokládat, že je to pravda, to je hodně naivní…

Konkrétní vědecké záležitosti v textu nejsou. Věty typu "tisíce vědců tvrdí, že tato teorie není pravdivá…" nejsou nic konkrétního.
27.7.2006 21:50 Robert Krátký | skóre: 94 | blog: Robertův bloček
Rozbalit Rozbalit vše Re: Evoluce?
Je to skoda, ze Kabrt pise takhle. Kdyby psal jinak, treba by jsi cetl dal.
Ale to's mě nepochopil. Mně nevadí drsná slova. Já jsem poukázal na to, že Kábrt neargumentuje, nýbrž vrší nepodložená tvrzení, která posiluje demagogickým překrucováním a zamlčováním faktů a mnoha dalšími způsoby - na tom textu by šly krásně vyučovat logical falacies. Chceš-li mi tvrdit, že zatímco v souhrnu a přímo v názvech těch "omylů" na začátku jsou demagogické bludy, kdežto v samotném textu jsou skvělé myšlenky, je to nesmysl.

Navíc jsem si body, na které ses ptal, přečetl celé (už před první odpovědí na tvůj dotaz) - a platí to, co jsem o nich napsal.
27.7.2006 21:55 Kyosuke | skóre: 28 | blog: nalady_v_modre
Rozbalit Rozbalit vše Re: Evoluce?
To je dobrý nápad. :-) Vzít editor a začít vepisovat poznámky? Chyby v logice, nepravdivá fakta, našlo by se určitě hodně materiálu, aby se ten text párkrát nafouknul... :-D
28.7.2006 11:51 podlesh | skóre: 38 | Freiburg im Breisgau
Rozbalit Rozbalit vše Re: Evoluce?
Je to skoda, ze Kabrt pise takhle. Kdyby psal jinak, treba by jsi cetl dal.
Kdyby psal jinak, byla by to jiná kniha.

Takhle to prostě nemá ani smysl číst. A prosívat snůšku blábolů nějakého fanatika kvůli zrnku pravdy?
27.7.2006 14:05 klassik | skóre: 24 | blog: Klassikov | Praha
Rozbalit Rozbalit vše Re: Evoluce?
Co mas proti komunismu? komunismus jako takovy neni spatny.Jen ho hodnotime dle toho jak byl zavedeny tady. V malych spolecnostech se da v komunismu zit v naprostem souladu
V podstatě nic nevím
27.7.2006 14:10 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce?
Tady (ani jinde) žádný komunismus nebyl. Tady byl reálný socialismus, to je něco úplně jiného.
27.7.2006 14:12 klassik | skóre: 24 | blog: Klassikov | Praha
Rozbalit Rozbalit vše Re: Evoluce?
v izraeli se ziji komunity v komunismu.
V podstatě nic nevím
27.7.2006 15:05 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?

co máš proti komunismu

.. tuhle otázku přece nemůžeš myslet vážně, že ne?

v izraeli se ziji komunity v komunismu

Pokud myslíš kibucy, mluvil jsem s pár lidmi, kteří tam byli a nic moc...

Podle mne taková utopie jako komunismus nemůže fungovat nikde. Prostě proto, že lidi jsou od přirozenosti zlí, závistiví, sobečtí atd. A pak je tu ještě řada dalších důvodů... ale to by vydalo na samostatnej blog (+ diskuzi k němu... kdo ví, možná by byla delší než 500 příspěvků ;-):-D

masožravá palma avatar 27.7.2006 15:09 masožravá palma | skóre: 6 | blog: Agnes | Matka měst
Rozbalit Rozbalit vše Re: Evoluce?
Já slyšela tohle: Komunismus na zemi nemůže fungovat, v nebi ho nepotřebujou a v pekle ho maj.
Mám městečko, podpořte průmysl a dopravu. Snižujte kriminalitu.
Jiste ze nemuze. A podle meho by ani nemela, neni totiz spravna ani jako teorie, protoze upira cloveku pravo na sebeurceni a vyuziti svych schopnosti. Rika: Je nam jedno co umis, ale ten druhej neumi nic, tak ty taky nic delat nebudes aby on ti to nezavidel a byl klid. To je kapitalni ustupek lidsky zavisti. Co je na tom dobreho?

Kazda implementace komunismu vzdycky skoncila tim, ze mala skupina lidi ovladala veskere vyrobni prostredky (hmmmmm, co mi to jen pripomina? ;) ...nebojuji komuniste zrovna proti tomu?) a jako bonus jeste nalhavala lidu, ze je kontroluje on.
FSF: “screw you for not wanting the stuff we produce”, People: “screw you for not producing the stuff we want."
27.7.2006 15:26 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce?
Rika: Je nam jedno co umis, ale ten druhej neumi nic, tak ty taky nic delat nebudes aby on ti to nezavidel a byl klid.

To je ovšem vaše interpretace. Ta, o které jsme se učili my, má jako hlavní zásadu: "Každý podle svých možností…", tedy pravý opak toho, co tvrdíte vy.

jsme se učili my
..."jste se ucili" nebo "vam bylo vtloukano do hlavy"? Komunismus podle meho funguje presne tak, jak jsem popsal a je jasne, ze lidem se to na rovinu rici nemuze, protoze by udelali revoluci hned v 48. Muselo se jim nejak nakukat, ze to, co je pro cloveka prirozene a v inteligentnich politickych usporadanich normalni, jim zustane.
FSF: “screw you for not wanting the stuff we produce”, People: “screw you for not producing the stuff we want."
27.7.2006 16:02 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce?
Bavím se o komunismu, tedy o jakémsi teoretickém uspořádání lidské společnosti, které je určitým způsobem definováno, ale nebylo nikdy v praxi realizováno (a nejspíš ani nebude). Zatímco vy mluvíte o reálném socialismu, tedy uspořádání společnosti, které v některých zemích bylo zavedeno a které se neosvědčilo (i když v několika zemích stále přetrvává).
27.7.2006 21:40 Robert Krátký | skóre: 94 | blog: Robertův bloček
Rozbalit Rozbalit vše Re: Evoluce?
Co mas proti komunismu? komunismus jako takovy neni spatny.Jen ho hodnotime dle toho jak byl zavedeny tady.
Oblíbený blud. Doporučuji si nejprve něco přečíst. Komunismus není žádná mírumilovná utopie - naopak: předpokládá využití násilí k dosažení svých cílů.
V malych spolecnostech se da v komunismu zit v naprostem souladu
Abstrahujeme-li z komunistické ideologie část, která mluví absenc i soukromého vlastnictví a sdílení výrobních prostředků atp., tak je to pro některé jistě lákavá myšlenka. Až na to, že pokulhává. Ty malé společnosti by totiž musely být prosty myslících lidských bytostí. V žádné - ani uzavřené - společnosti totiž nemůže delší dobu fungovat systém sdílení a přerozdělování bez pomoci síly, která k tomu lidi bude nutit.
27.7.2006 12:07 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Evoluce? Evoluce!

Původně jsem se k té Kábrtově knize moc vyjadřovat nechtěl, protože jsem předpokládal, že míru její hlouposti, nenávistnosti a zkreslování faktů musí vidět každý. Bohužel ale někteří přítomní kreacionisté tvrdí, že ten člověk je vědec a vychází výhradně z ověřených faktů.

Takže se podívejme na jeden z jeho často opakovaných argumentů, kdy tvrdí, že biologické druhy jsou stálé a že žádné mezidruhy nejsou pozorovatelné, natož abychom byli schopni nějaký vytvořit. Podívejme se třeba do ledničky: v té naší máme nektarinky. Když jsem byl malý, žádné nektarinky se neprodávaly; což o to, ono se neprodávalo ani kiwi, dokonce často ani pomeranče. Jenže u nektarinek byl důvod jiný: ony se neprodávaly proto, že neexistovaly. Vzpomínám si, že když mi bylo asi deset, dočetl jsem se, že vědcům někde v zahraničí se podařilo vyšlechtit nový druh ovoce, který vypadá a chutná jako broskev, ale místo chlupaté slupky má hladkou, asi jako jablko. Pokud jsou jednotlivé druhy ostře ohraničené a nové nevznikají, proti čemu to vlastně demonstrují ti odpůrci GMO? Kde se vzaly ty spousty kmenů bakterií resistentních na antibiotika, které se nám (podle mne) vyvinuly za pár desítek let jako reakce na změnu vnějších podmínek?

Co se týká nedostatku zkamenělých mezidruhů, autor opět ignoruje nejjednodušší vysvětlení, protože by se na něm asi nebylo čemu posmívat. Představme si podložku s různě hlubokými důlky a na ní kuličku (prostě to, čím se při fyzice demonstruje pojem metastabilní poloha). Kulička se pochopitelně ustálí v některém důlku. Začněme teď deskou třást s náhodnou intenzitou, chvíli méně, chvíli více. Čas od času se stane, že kulička získá dostatek energie na to, aby přeskočila z jednoho důlku do druhého. pokud bychom ale sledovali polohu kuličky v čase, většinu času by byla v některém z důlků, na "hřbetech" se objeví jen velmi zřídka. Takže když budeme v náhodných okamžicích desku fotografovat, téměř na všech fotografiích bude kulička v některém důlku, jen zcela výjimečně se nám může podařit ji vyfotit při přechodu mezi důlky. Pokud chápeme důlky jako analogii jednotlivých biologických druhů a třesení deskou jako analogii náhodných mutací, máme jednoduchou odpověď, proč nevidíme zkamenělé mezidruhy: v nestabilních přechodových polohách systém stráví jen velmi málo času, at to tím méně, čím je "výška energetické bariéry" vyšší.

Lahůdkou pak je sledovat, jak pan Kábrt dokáže i učebnicové příklady svědčící pro evoluci (ptakopysk, archeopteryx…) prohlašovat za příklady, které ji vyvracejí - aniž by ovšem jen slovem naznačil proč.

Daniel Kvasnička ml. avatar 27.7.2006 12:21 Daniel Kvasnička ml. | skóre: 52 | blog: The Joys and Sorrows of Being an IT Freak | Ostrava
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
No me by zajimal vas nazor na to zakladni: jak se z nezive hmoty vyvinula ziva hmota. Pasteur, entropie atp...
FSF: “screw you for not wanting the stuff we produce”, People: “screw you for not producing the stuff we want."
27.7.2006 12:29 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Kdyby pan Kábrt chtěl ukázat, že živá hmota z neživé vzniknout nemůže, napřed by řekl jak se pozná to prvé a to druhé a kde je mezi tím zcela jasný a nepřekročitelný předěl. Místo toho kafrá. Podle mě mezi tím žádná jasná čára ,dál už ne` není a tedy tuto hranici nevidím rozhodně jako nepřekročitelnou.
Copak toho není dost?
27.7.2006 12:29 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Náhodnými fluktuacemi. Samozřejmě že než se to podařilo, trvalo to déle, než pozdější mezidruhové mutace, ale nepovažuji to za apriorně vyloučené. Navíc si nemyslím, že mezi živou a neživou hmotou je tak ostrá dichotomie. Třeba na to, zda lze viry považovat za živé organismy, není vůbec jednotný názor.
Daniel Kvasnička ml. avatar 27.7.2006 12:40 Daniel Kvasnička ml. | skóre: 52 | blog: The Joys and Sorrows of Being an IT Freak | Ostrava
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Myslite, ze to co bylo na zacatku k dispozici za latky se neda bezpecne oznacit za nezive?
FSF: “screw you for not wanting the stuff we produce”, People: “screw you for not producing the stuff we want."
27.7.2006 12:46 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
To asi ano, takový atom vodíku je neživý dost spolehlivě. Ale jak už jsem řekl, nemyslím si, že lze mezi živým a neživým stanovit ostrou hranici.
27.7.2006 13:05 Filip Jirsák | skóre: 67 | blog: Fa & Bi
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Jednoduše. Nejprve byla neživá hmota (relativně jednoduché molekuly), vznikaly a zanikaly různé složitější vazby, ale některé ze složitějších stačily ještě před zánikem vytvořit ještě složitější – a ty, které nezanikly, měly v sobě nejspíš nějakou vazbu, která bránila zániku, takže mohly vytvářet stále složitější a složitější vazby. A někde na konci toho byl člověk, který viděl některé výrazné znaky, odlišující ty jednoduché vazby od těch velmi složitých, tak si to pracovně nazval neživé a živé. Což ovšem neznamená, že i v reálu je to takhle oddělené. Samozřejmě, mouchy, červy a plísně nevznikají z prachu, to už je od sebe komplexnostní příliš vzdálené. Ale co třeba takové viry?

Jinými slovy, otázka po tom, jak se z neživé hmoty stala hmota živá, je stejného druhu, jako jak se ze dne stává noc.

Pasteura teď studovat nemusím, ale s entropií je to taky poměrně jednoduché. Entropie je jedna "síla", ale proti entropii může působit nějaká jiná zákonitost, která vede naopak ke složitějším nebo komplexnějším systémům. Podobně jako uvnitř jádra atomu působí silná a slabá interakce, ale ty působí jen na malou vzdálenost, ale za to silně. Proti nim pak působí elektromagnetická síla a gravitace, které zase působí na velkou vzdálenost, ale jsou velmi slabé. Takže v jádru atomu se uplatní víc silná a slabá interakce, na vzdálenostech řádově větších se uplatní elektromagnetizmus a gravitace. Podobně to může být i s entropií.

Takže jsou v zásadě tři možnosti – buď se byť i v nějaké části systému něco vyvíjí ke kvalitativně lepší variantě (např. z neživé hmoty vznikne život), nebo je vše stále stejné (a bůh je mrtev), nebo jde vývoj naopak ke kvalitativně horším variantám. Podle toho, co lidstvo zatím zjistilo, to vypadá na první variantu, tedy kvalitativní zlepšování. Nejprve při velkém třesku vznikl prostor a čas se základními fyzikálními zákonitostmi; to dalo vzniknout elektromagnetickým, gravitačním, silným a slabým silám, kvarkům, atomům; z toho mohly začít vznikat planety, slunce, galaxie; na minimálně jedné takové planetě tak mohl začít vznikat život; ze života mohla začít vznikat inteligence, která je schopná tyhle věci vnímat, popisovat, zkoumat, uvědomovat si je. Všimněte si, že každý z těch stupňů potřebuje nižší stupeň jako svůj základ, během vývoje není možné jasně říci, kde končí jeden stupeň a začíná vyšší – ale pokud onen vyšší stupeň vezmeme jako obecnou "třídu", jde nepochybně o kvalitativní posun vpřed.

A mimochodem, tenhle postup (od horšího k lepšímu) se přisuzuje všem alespoň trochu "rozumným" bohům v kreacionistických teoriích – i v nich přeci bůh nejprve stvoří nebe a zemi, světlo a tmu, teprve pak život a až nakonec člověka. A vždy je to za nějakým účelem, aby něco bylo lepší. Bůh nikdy neříká "a teď chátrejte a zanikejte".

Takže tenhle antientropický princip mají oba přístupy společný – je to logické, máme to odpozorováno, že takovýhle princip funguje, takže ho do teorií zahrnujeme, chceme-li, aby popisovaly svět pravdivě. Otázka je proč tenhle princip funguje – a na to věda zatím pokud vím odpověď nemá, ale jednou z možných odpovědí na tuhle otázku je i bůh.
27.7.2006 13:18 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
IMHO princip rostoucí entropie vůbec nevyvrací možnost vzniku lokálních (v prostoru i čase) vysoce organizovaných struktur. Naopak, pokud by tomu tak nebylo, znamenalo by to nižší míru entropie. Budu-li mít kvalitní generátor náhodných bitů, čas od času z něj vypadne deset jedniček po sobě, čas od času dokonce i sto jedniček po sobě atd. Naopak, generátor, který by takové věci nedělal, by byl špatný.
27.7.2006 13:22 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Takto by to ovšem ztížilo možnost určit kdy se to o čem se bavíme stalo, protože základní znak skutečně dobrého generátoru není to, jestli z něj vypadne deset jedniček nebo sto, ale že ani za boha (;-)) nemůžu zjistit, co z něj vypadne příště :-)
Copak toho není dost?
masožravá palma avatar 27.7.2006 18:04 masožravá palma | skóre: 6 | blog: Agnes | Matka měst
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!

Z evoluční teorie AFAIK nutně nevyplývá vznik živé hmoty z neživé. Klidně první živou buňku mohl stvořit Bůh, případně mohl i sem tam nějakou mutaci popostrčit.

Entropie nevylučuje kvantové fluktulace a život spotřebovává tolik energie k uchování informace, že druhou větu termodynamickou neporušuje.

Vyčítáš Pasteurovi, že za několik hodin na velmi omezeném prostoru nedokázal zreprodukovat děj, který se stal na prostoru výrazně větším v mnohem větším časovém horizontu? btw. momentálně se mi nechce hledat zdroj, ale je dokázáno, že když se vezme kbelík s vodou (čistou bez života) hodí se do něj různé minerály a začne se na to svítit ultrafialově, začnou v kebláku vznikat molekuly podobné RNA - čili něco velmi podobného základním stavebním kamenům života.

Mám městečko, podpořte průmysl a dopravu. Snižujte kriminalitu.
Daniel Kvasnička ml. avatar 27.7.2006 18:23 Daniel Kvasnička ml. | skóre: 52 | blog: The Joys and Sorrows of Being an IT Freak | Ostrava
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Klidně první živou buňku mohl stvořit Bůh, případně mohl i sem tam nějakou mutaci popostrčit.
No to zcela urcite, ale s tim u evolucionisty neuspejes.
Vyčítáš Pasteurovi...
To bude asi nedorozumeni. Nic mu nevycitam. Dotycneho jsem se ptal, jake ma nazory na Pasteurovy pokusy dokazujici nemoznost vzniku zivota z mrtve hmoty. Pripadne mi pravdepodobnejsi prave ten zasah inteligence - Boha.
FSF: “screw you for not wanting the stuff we produce”, People: “screw you for not producing the stuff we want."
27.7.2006 18:46 Filip Jirsák | skóre: 67 | blog: Fa & Bi
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Pasteurovy pokusy dokazujici nemoznost vzniku zivota z mrtve hmoty.
Dokázat nemožnost nejde pokusem. Nemožnost jde dokázat pouze teoretickým aparátem. (Např. dokázat, že neexistuje sudé prvočíslo větší než 2 nemůžu tak, že budu brát různá sudá čísla větší než dva a zkoumat, zda jde o prvočíslo, a když mne to přestane bavit, prohlásím, že takové číslo neexistuje.) Pokusem (dobře udělaným) je možné zjistit pravděpodobnost nějakého jevu.

S tím, že první živou buňku stvořil bůh, asi u evolucionisty opravdu neuspějete, ale klidně je možné to pozměnit tak, že bůh velkým třeskem vytvořil vesmír naprogramovaný tak, aby vznikly zárodky života a později i první buňky. Pokud s tímhle bude mít někdo problém, už to nebude kvůli teorii evoluce. Ale věda rozhodně není v rozporu s vírou…

Každopádně ale odkazované PDF není o střetu dvou teorií nebo o víře, to je prostě popírání faktů, výmysly a důkazy vykřičníkem.
Daniel Kvasnička ml. avatar 27.7.2006 19:23 Daniel Kvasnička ml. | skóre: 52 | blog: The Joys and Sorrows of Being an IT Freak | Ostrava
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Dokázat nemožnost nejde pokusem. Nemožnost jde dokázat pouze teoretickým aparátem. (Např. dokázat, že neexistuje sudé prvočíslo větší než 2 nemůžu tak, že budu brát různá sudá čísla větší než dva a zkoumat, zda jde o prvočíslo, a když mne to přestane bavit, prohlásím, že takové číslo neexistuje.) Pokusem (dobře udělaným) je možné zjistit pravděpodobnost nějakého jevu.
To dava smysl, souhlasim.
S tím, že první živou buňku stvořil bůh, asi u evolucionisty opravdu neuspějete, ale klidně je možné to pozměnit tak, že bůh velkým třeskem vytvořil vesmír naprogramovaný tak, aby vznikly zárodky života a později i první buňky. Pokud s tímhle bude mít někdo problém, už to nebude kvůli teorii evoluce. Ale věda rozhodně není v rozporu s vírou…
To je z meho hlediska zrejme nejpravdepodobnejsi, ackoliv muj nazor kolem tohto bodu v podstate kolisa.
Každopádně ale odkazované PDF není o střetu dvou teorií nebo o víře, to je prostě popírání faktů, výmysly a důkazy vykřičníkem.
No, myslim, ze jsem jasne deklaroval, ze se za to PDF nestavim tak, jak se mi tu nekteri zrejme snazi vnutit. Pouze me zaujalo a nektere veci v nem a tenhle blogpost jsem napsal, abych zajistil jak na to budou reagovat ateisticti evolucioniste.
FSF: “screw you for not wanting the stuff we produce”, People: “screw you for not producing the stuff we want."
masožravá palma avatar 27.7.2006 18:55 masožravá palma | skóre: 6 | blog: Agnes | Matka měst
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Klidně první živou buňku mohl stvořit Bůh, případně mohl i sem tam nějakou mutaci popostrčit.
No to zcela urcite, ale s tim u evolucionisty neuspejes.

Já to tvrdím a jsem evolucionista. => Vyvráceno.

Bůh existující mimo prostor a čas (s možností do něj zasahovat) nepodléhá přírodním zákonům a detekovatelnosti. (Můj názor a názor více než jednoho z mých věřících přátel, známých a příbuzných. Jiří Grygar říká také něco podobného.)

Vyčítáš Pasteurovi...
To bude asi nedorozumeni. Nic mu nevycitam. Dotycneho jsem se ptal, jake ma nazory na Pasteurovy pokusy dokazujici nemoznost vzniku zivota z mrtve hmoty. Pripadne mi pravdepodobnejsi prave ten zasah inteligence - Boha.

Pasteurovy pokusy IMNSHO nic nevyvracejí ani nepotvrzují a považuji je za dost zcestný argument. To vyčítání bylo básnickým obrazem.

Mám městečko, podpořte průmysl a dopravu. Snižujte kriminalitu.
Mikos avatar 27.7.2006 19:30 Mikos | skóre: 34 | blog: Jaderný blog | Praha
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Jistě znáš teorii o neviditelném růžovém jednorožci ;-) Ta je zcela rovnocenná s teorií tvého Boha :-) A to je také důvod, proč je Bůh nadbytečný (a zbytečný) a proč se jím (ani neviditelným růžovým jednorožcem) nemá cenu zaobírat. A podle Occamovi břitvy ani není důvod, proč by měl nějaký bůh existovat ;-)
CETERUM CENSEO DRM ESSE DELENDAM Ostatně soudím, že DRM musí být zničeno!
Mikos avatar 27.7.2006 19:35 Mikos | skóre: 34 | blog: Jaderný blog | Praha
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Tedy tak to alespoň vidím já. Nechci nikomu brát jeho víru, ať si každý věří čemu chce, třeba tomu neviditelnému růžovému jednorožci nebo ufounům se zelenými tykadélky v létajících talířích (i když to není úplně ten správný příklad, protože ty mají k reálnému světu rozhodně blíže než nějaký Bůh, bůžek či růžový jednorožec ;-)). Na víře nic špatného není, co nesnáším je když někdo chce svou víru vnucovat jiným... a také nesnáším církve, které jsou u mě de facto na stejné úrovni jako mafiánské organizace, NSDAP nebo KSČ.
CETERUM CENSEO DRM ESSE DELENDAM Ostatně soudím, že DRM musí být zničeno!
Daniel Kvasnička ml. avatar 27.7.2006 19:45 Daniel Kvasnička ml. | skóre: 52 | blog: The Joys and Sorrows of Being an IT Freak | Ostrava
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
No tak to uz se tady jednou resilo.
FSF: “screw you for not wanting the stuff we produce”, People: “screw you for not producing the stuff we want."
27.7.2006 19:51 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Že by něco jako "perpetum mobile" ?? :-D
Marek Bernát avatar 27.7.2006 21:36 Marek Bernát | skóre: 17 | blog: Arcadia
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Nie celkom, entropia sa stále zvyšuje, takže časom (nanajvýš pár miliárd rokov) vymrú všetci kresťania aj ateisti. Potom bude pokoj :-)
physics.stackexchange.com -- Q&A stránky o fyzike v štýle StackOverflow.
27.7.2006 19:50 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!

Ta je zcela rovnocenná s teorií tvého Boha

Fascinuje mne, když někdo, kdo o Bohu téměř nic neví je přesvědčen, že je oprávněn přirovnávat ho k růžovému jednorožci.

Fantastické na tom je právě to, že tento příspěvek popírá sám sebe, protože kdyby pisatel něco víc o zmiňovaném Bohu věděl, nikdy by ho k neviditelnému jednorožci atd. přirovnat nemohl. :-D

Marek Bernát avatar 27.7.2006 21:59 Marek Bernát | skóre: 17 | blog: Arcadia
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Nemáte pravdu, z celkom prostého dôvodu. Vy neviete nič o tom jednorožcovi :-)
physics.stackexchange.com -- Q&A stránky o fyzike v štýle StackOverflow.
Daniel Kvasnička ml. avatar 27.7.2006 19:37 Daniel Kvasnička ml. | skóre: 52 | blog: The Joys and Sorrows of Being an IT Freak | Ostrava
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Já to tvrdím a jsem evolucionista. => Vyvráceno.
myslel jsem standartniho evolucionistu, tedy ateistu.
Bůh existující mimo prostor a čas (s možností do něj zasahovat) nepodléhá přírodním zákonům a detekovatelnosti. (Můj názor a názor více než jednoho z mých věřících přátel, známých a příbuzných. Jiří Grygar říká také něco podobného.)
To je reakce na co? Nic takoveho nepopiram. To vysvetluj agresivnim ateistum neustale prahnoucim po hmatatelnem dukazu ci ptajicim se kde se Buh vzal. Nevim jestli sis v te krvave vrave poslednich dni vsimla, ze jsem krestan ;-)

Tahle diskuse je vubec zajimava. To PDF zde pritomne rozzurilo natolik, ze zamenili Pavla Kabrta za Daniela Kvasnicku a vylili si svuj vztek na nem :-) Hajil jsem pouze to, ze ta kniha obsahuje fakta, protoze me fascinoval pohled na ateisticke evolucionisty neschopne si precist neco, co prohlasuje druha strana. Oni ale zrejme chteli zjistit, jestli umim pouzivat Ctrl+C a Ctrl+V a snazili se me ptat kde tam ty fakta jsou.

To, co jsem napsal to blogpostu samotneho a co vyjadruje stale muj nazor (i kdyz Kabrtova kniha hraje u me diky strance avizovane M. Vyskocilem mnohem mensi roli), to kazdy ignoroval. Coz neznamena, ze nemam otazky ci pochybnosti...ale kdo nema? Jen fanatici (tech je tady docela dost).
FSF: “screw you for not wanting the stuff we produce”, People: “screw you for not producing the stuff we want."
27.7.2006 20:34 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Už zase. Už zase se cpeš do role ubližovaného a jiné stavíš do pozice fanatiků. Tady bylo zpochybněno všechno co si kdo z té knihy přečetl, myslím, že kdyby to třeba byly strojnické tabulky, tak bys jim po prvních deseti chybách (na jediné stránce) přestal hodně rychle věřit a šel bys pro jiné. Ale tohle ne, tam jsou přeci fakta (jistě, ale co z toho?), čtěte dál, tam je pravda, tu musíte pochopit, fanatici.

Je-li tu něco fanatického, tak je to tvoje snaha udělat z jiných fanatiky.
Copak toho není dost?
Daniel Kvasnička ml. avatar 27.7.2006 21:19 Daniel Kvasnička ml. | skóre: 52 | blog: The Joys and Sorrows of Being an IT Freak | Ostrava
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Zablokoval jsem te a zarekl se, ze te budu ignorovat, ale co je moc, to je moc. JESTLI TADY NEKDO NEKOMU NECO PODSOUVA, TAK JSES TO TY. Podsouvas me, ze pritomnosti faktu v te knize obhajuji jeji naprostou verohodnoust...ale to jsem tu nikdy nerekl. Co bych odvolal zpatky, tak to je to, ze Kabrt je vedec.

Lez na strance v knize nemuze nijak oslabit dulezitost faktu, byt by byl treba hned vedle te lzi. A o takovych vecech jsem se chtel bavit. Maji dulezitost? Nemaji? Vi se o nich? Co na to evoluce? Jak kreace? Co treba ta latimerie? Nalezy? To jsou fakta a je zajimave si je precist, zeptat se sam sebe, co to znamena pro tuhle zalezitost a pak si treba precist neco jineho (ten web, co linkoval M. Vyskocil).
FSF: “screw you for not wanting the stuff we produce”, People: “screw you for not producing the stuff we want."
27.7.2006 21:29 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Ten web co linkoval Michal Vyskočil jsem četl už dávno.

Ne, přečti si jak si začal. Blog samotný. Už tam podsouváš čtenáři, že když se tím nebude zabývat, že když z toho nenávistného díla nebude dolovat aspoň něco smysluplného z každého písmenka co tam je, tak bude fanatik. Normální čtenář si přečte část, objeví nesmysly a číst přestane. Jenže takto to u tebe nefunguje, protože ty z něj za každou cenu musíš udělat fanatika. A já znova (a znova) opakuji, že na ,,čti dál a pozorněji, je to tam`` si hrát nebudu. Ta kniha je nedůvěryhodná jako celek, nicméně samozřejmě ani Kábrt není takový superman aby se mu tam někde nezapletlo něco pravdivého.

Jenže studovat dílo, kde si člověk musí každou větu ověřovat, protože tomu prostě na první pohled věřit nemůže, to dá dost práce. Opakuji, předvěď z toho díla ucelené myšlenky, něčím je dolož a můžeme se o nich bavit. Nutit nás to číst beru z tvé strany jako fanatismus. Věřím, že v tomto názoru nejsem sám. Málokdo z nás tu má dost času, znalostí a ochotu se tomu věnovat, aby sestavoval něco jako v té odkazované polemice. Jenže když to neuděláme, označuješ nás za fanatiky. Dej si ty tu práci, když něco chceš.
Copak toho není dost?
27.7.2006 22:23 Kníže Ignor | skóre: 19 | blog: stoupa
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Co máš pořád s tou latimérií? Jakým způsobem napadá evoluční teorii? Už se tě tu na to někdo ptal, ale odpověď nedostal. Třeba budu mít víc štěstí :-D
Jestli máš zálohu mého blogu, tak mi ji pošli. Nějak jsem si ho smazal :-)
Daniel Kvasnička ml. avatar 28.7.2006 01:07 Daniel Kvasnička ml. | skóre: 52 | blog: The Joys and Sorrows of Being an IT Freak | Ostrava
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Uvadel jsem to jako priklad konfrontacniho zpusobu, kterym formuju svuj nazor... Proste si neco prectu a pak sleduju, jak to nekdo strha. Tak si reknu, OK, tak se podivame jinam. Proste evoluce nazoru ;-)

Jinak, pokud si pamatuju, o latimerii se mluvi proto, ze se predpokladalo, ze uz je par desitek milionu let vyhynula a argumentovalo se tim ve prospech evoluce. Do jake miry to dava smysl nebo ne a o jake spojitosti jde, to uz ted nevim. Precti si tu cast, kde o tom mluvi Kabrt a pak nejakou literaturu z druhe strany barikady a utvor si nazor.
FSF: “screw you for not wanting the stuff we produce”, People: “screw you for not producing the stuff we want."
27.7.2006 21:00 Filip Jirsák | skóre: 67 | blog: Fa & Bi
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Hajil jsem pouze to, ze ta kniha obsahuje fakta
Vzhledem k tomu, co jsem si z té knihy stačil přečíst, kdyby tam bylo napsáno, že 2 + 2 = 4, tak si to jdu někam ověřit. Protože mám pocit, že se dá s vysokou mírou pravděpodobnosti spolehnout na to, že co autor předkládá jako fakt, je ve skutečnosti nějak jinak :-(
27.7.2006 20:29 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Opakuji se, ale nechápu to neustále agresivní podsouvání něčeho co nikdo neřekl. Předložte ucelenou a aspoň trochu reálnou teorii jak by kreacionismus měl fungovat, ne jenom upozorňování na ,nedostatky` evoluce. To je sice hezké, ale zatím jsem neviděl žádný, se kterým by se dalo bezvýhradně souhlasit a sám o sobě něco podstatného znamenal. Pokud tvrdíte, že evoluce má díry, tak kreacionismus je jedna velká díra a občas něco málo. A jak musím znova zdůraznit, nemám povinnost zabývat se každou kravinou kterou mi někdo hodí na stůl, nebudu číst dál abych konečně našel tu pravdu.

Jsi troll, nastuduj si to, pak to pochopíš. Opovaž se říct ne, to bys byla fanatik a ubohý ateistický odmítač pravdy!
Copak toho není dost?
27.7.2006 21:34 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Předložte ucelenou a aspoň trochu reálnou teorii jak by kreacionismus měl fungovat, ne jenom upozorňování na ,nedostatky` evoluce.

No, tu najdeš třeba v Bibli. Je ucelená, naprosto reálná, časem prověřená. ;-)
Jen dodám, že je třeba číst přesně.
- Eva nedala Adamovi jablko
- na Vánoce nikdo nepřeje pokoj lidem dobré vůle
- nikde není nic o dědečkovi na obláčku,
- ani o krvelačném, despotickém trestajícím bohu...
Takže, když se z toho odpáře "folklór" a "lidová tvořivost"
(viz např. čerti a kotle..)
tak zbude právě to, co hledáš ;-)
27.7.2006 22:05 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
ani o krvelačném, despotickém trestajícím bohu...

Tak to mám asi nějakou jinou verzi než vy…

28.7.2006 11:28 Michal Vyskočil | skóre: 60 | blog: miblog | Praha
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Spousta křesťanů Starý zákon moc neuznává. Je pravda, že těžiště Nového zákona je jinde, nicméně dokud bude v Bibli i Starý zákon, musí se s určitými pasážemi prostě poprat ;-)
When your hammer is C++, everything begins to look like a thumb.
27.7.2006 12:24 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Myslel jsem, že nektarinka v tomto smyslu není považována za nový "druh" ne? Nový druh chápu něco geneticky odlišného, (co nemůže vzniknout křížením, genetickou úpravou nebo mutací)?
Viz odstavec Mendelův experiment.
Já jsem tuto knihu četl ještě před Kábrtovým překladem a dodatky (doporučuji je zde ignorovat) a jsou v ní věci, které mne vedly k zamyšlení.. možná je lepší se podívat po originálu :-(
27.7.2006 12:31 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
V každém případě už jenom toto křížení popírá základní Kábrtovu představu, že druhy jsou jasné dané a zcela neporovnatelné a vzájemně nezaměnitelné.
Copak toho není dost?
27.7.2006 12:44 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Řekl bych, že tady je právě jádro sporu, i když to není na první pohled vidět. Kreacionisté vidí druhy jako striktně oddělené, ti liberálnější jsou ochotni připustit určité drobné odchylky a posuny, ale mezi jednotlivé druhy staví nepropustnou bariéru. Já chápu druhy spíše jako jakési "metastabilní stavy genomu", takže si dokážu představit posloupnost mezistavů mezi např. psem a kočkou, u nichž nepůjde přesně říci, kam až je to pes a kde už začínají kočky. Třeba i Vopěnka (který je AFAIK věřící, což se obvykle s evolucionismem moc neslučuje) ve své knize, když potřeboval příklad polomnožiny, použil posloupnost od "opičáka Charlieho" k Charlesi Darwinovi a jako polomnožinu ty, kteří jsou opicemi (Úvod do matematiky v alternatívnej teórii množín, Alfa 1989, str. 41). Takže bych řekl, že ta myšlenka neostrého rozhraní mezi druhy není až tak nepřirozená.
27.7.2006 13:33 Filip Jirsák | skóre: 67 | blog: Fa & Bi
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Ona je tohle taková "zrada" lidského myšlení. Mám ale pocit, že je to poměrně novinka, že to dříve nebylo a je to otázka tak posledních dvou století (začíná dle mého s newtonovskou fyzikou).

Svět kolem nás není diskrétní, ale spojitý – neexistuje hranice mezi neživým a živým, mezi Zemí a vesmírem, mezi atomem a jeho okolím, mezi opicí a člověkem. Lidské myšlení a jazyk slouží ale k oddělování různých věcí, k třídění do skupin podle stejných podstatných znaků. Takže když se řekne pojem "jablko" každý ví o co jde do té míry, dokud se setkává s běžnými jablky. Ale jakmile bychom měli možnost zkřížit jablko s hruškou a postavit vedle sebe různé mezifáze, nebo vidět různé vývojové předky jablka, nedokážeme určit, co jablko ještě je a co není. Stejně tak o psu řekneme, že je živý a kámen označíme za neživý. To jsou ale ty extrémní jednoznačné stavy, které jsou pro nás důležité a pro které máme pojmenování. Ale ten pes se musel nějak narodit a nějak zemře – a tam už nedokážeme přesně stanovit hranice.

Lze si to představit třeba na mapě. Na běžné mapě máme mezi jednotlivými státy hranice, co je uvnitř hranic jednoho území je jeden stát. To je to diskrítní vnímání – a my si často myslíme, že takhle vnímáme svět a takovýhle svět opravdu je. Představme si ale, že pro státy nebude důležité to geopolitické rozdělení, ale stát bude znamenat spíš příslušnost k hlavnímu městu (hlavní město bude onen podstatný a rozlišovací znak). Pak najednou dokážeme říci, že Plzeň patří do pražského státu, České Budějovice taky, Hamburg patří naopak do berlínksého státu – ale někde jinde už nedokážeme určit, pod který "městský stát" nějaké území spadá.

Dobře je to vidět na současné fyzice. Dokud se fyzika zabývala atomy a kvarky, pořád ještě fungoval náš způsob myšlení – atom jsme si představovali jako něco ohraničeného (odtud má ostatné také svůj název). Jak se zdá, v kvantové fyzice už ale tenhle náš způsob zjednodušeného popisování světa (jeho třídění) nemůžeme použít, protože na této úrovni už jsou podstatné ty jevy, které souvisí se spojitostí. Ale my takovýmhle způsobem vůbec nedokážeme přemýšlet, proto nám připadá kvantová fyzika tak záhadná, proto je v ní spousta paradoxů.

No a dnes děláme ve spoustě oblastí tu chybu, že naše fuzzy termíny a myšlení chápeme jako ohraničené (diskrétní), a pak to přenášíme i na svět kolem nás a myslíme si, že je také takhle rozškatulkovaný. Ono ostré rozhraní tedy není nic přirozeného, je to pouze lidský výmysl. A je to potřeba vědět, a je potřeba vědět, že pokud chci něco dobře zkoumat, nemůžu to dělat tak, že budu hledat ostrou hranici mezi termíny, které popisují úplně jiný pohled na věc, ale musím si najít takové termíny nebo myšlenkové pojmy, které mi budou popisovat a rozlišovat to podstatné na tom, co zkoumám. Pak totiž opět onen lidský způsob přemýšlení o věcech nebude při zkoumání světa na závadu, ale bude ku prospěchu věci.
27.7.2006 13:44 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Ono to ostré vnímání světa bylo v dané době spíše nutností danou nedostatečným matematickým aparátem. Tehdejší matematika měla dost problémů s popisem ostře viděného světa, natož aby si ho ještě komplikovala nějakou neostrostí. Vždyť i ten Newton musel posunout hranice tehdejší matematiky (současně s Leibnizem) a vytvořit infinitesimální počet. Už to samo bylo zbořením jednoho zakořeněného myšlenkového stereotypu, se kterým se vlastně potýkal už Zenon.
27.7.2006 14:16 Filip Jirsák | skóre: 67 | blog: Fa & Bi
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Nemám nic proti ostrému vnímání světa. Způsob, jak lidé svět vnímají je právě hledání těch ostrých okrajů. Pro lidské uvažování v pojmech je to způsob charakteristický a uvažovat bez oněch ohraničení moc neumíme a když už tak někdy někdo přemýšlí, je dost problém, jak to sdělit ostatním tak, aby to nevypadalo jako šarlatánství. Ale je potřeba si uvědomovat, že ono ostré vnímání světa je jen vnímání a nepromítat si tu ostrost zpátky do okolního světa.
27.7.2006 14:27 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Přesně, nesmí se zapomínat na to, že je to jen model. Model je od toho, aby popisoval skutečnost, takže je třeba jeho předpovědi porovnávat s realitou a v případě podstatné neshody model opravit - nebo nahradit jiným. Tak funguje věda. Lidé jako pan Kábrt ale pracují obráceně: snaží se realitu přizpůsobit svému modelu.
27.7.2006 13:20 frdrx | skóre: 29 | blog: frdrx
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Křížení je jedním ze způsobů vzniku nových druhů; a velmi častým, mnohem častějším než mutace.
Patička mi slouží k tomu, abych si lépe poznal svoje příspěvky.
27.7.2006 13:21 frdrx | skóre: 29 | blog: frdrx
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Alespoň u rostlin.
Patička mi slouží k tomu, abych si lépe poznal svoje příspěvky.
27.7.2006 14:19 ajikdpoe | skóre: 23 | blog: dvh
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
http://memento.junweb.cz/jablko/genetika.htm - to je hlupost, autor predpoklada ze replikacia DNA je dokonala a preto geny mozu len ubuduat ale replikacia DNA nieje ani zdaleka dokonala (vid. rakovina). Nove geny mozu bezne vznikat prave chybami pri replikacii DNA.

Inak tusim jablka "Jonatanky" vznikli tak ze semena sa ozarovali radiaciou.
27.7.2006 14:23 ajikdpoe | skóre: 23 | blog: dvh
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Oh, este som zabudol, geny su len zhluk pismen DNA, v skutocnosti geny ako take neexistuju to len clovek si povedal ze 25 az 32 pismeno v:

atcgtgcatgactgctagctagctagttatgcgatcgatgctagctgcatatattcggactagtcgatcgatgcatgatcgatcgac

Je gen "xyz123" - to k tomu ostremu vnimaniu
27.7.2006 14:39 frdrx | skóre: 29 | blog: frdrx
Rozbalit Rozbalit vše Re: Evoluce? Evoluce!
Geny samozřejmě existují, ale ne jako shluk písmen a už vůbec ne sedmi.
Patička mi slouží k tomu, abych si lépe poznal svoje příspěvky.
unknown_ avatar 27.7.2006 14:30 unknown_ | skóre: 30 | blog: blog
Rozbalit Rozbalit vše Re: Evoluce?
muzu se zeptat kterej z bohu mel ty lidi vytvorit?
27.7.2006 14:37 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce?
Z každé sady aspoň jeden… :-)
27.7.2006 14:38 zabza | skóre: 52 | blog: Nad_sklenkou_cerveneho
Rozbalit Rozbalit vše Re: Evoluce?
Mnohé rasy věří, že vesmír byl stvořen nějakým bohem. Jen Džatravartidové z Viltvodlu VI věří, že vesmír vysmrkla z nosu bytost zvaná Velký zelený Křečopažout. Džatravartidové, kteří žijí v neustálém strachu, že jednou nastane to, co nazývají příchodem velkého bílého kapesníku, jsou malí modří tvorové s více než padesáti rukama. Díky tomu jsou jedineční v dějinách vesmíru, protože vynalezli dřív intimspray než kolo. Kromě obyvatel Viltvodlu VI však teorii Velkého zeleného Křečopažouta téměř nikdo nepřikládá valnou míru, a tak vesmír zůstává hádankou, pro niž všichni neustále hledají vysvětlení.
unknown_ avatar 27.7.2006 15:08 unknown_ | skóre: 30 | blog: blog
Rozbalit Rozbalit vše Re: Evoluce?
I vysmrknuti je stvoreni
27.7.2006 15:13 zabza | skóre: 52 | blog: Nad_sklenkou_cerveneho
Rozbalit Rozbalit vše Re: Evoluce?
ale dost nechutný! :-)
27.7.2006 15:12 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce?
Smysl života je právě v tom na to přijít (a pak se podle toho zachovat) ;-)
kyknos avatar 28.7.2006 09:14 kyknos | skóre: 18 | blog: Quid novi? | Ranša Rosa
Rozbalit Rozbalit vše Evoluce přirodním výběrem je nezpochybnitelný fakt
Tak to je. Pánbíčkáři smiřte se s tím. Byla přímo pozorována v přírodě (např. v některých afrických jezerech je evoluce ryb tak rychlá, že speciace probíhá přímo před našima očima). Lze ji také potvrdit experimentálně.

Diskutovat lze o tom, jaké jsou přesné detaily či zda je to jediný faktor uplatňující se při vzniku druhů atd. ale púopírat evoluci je totéž jako popírat gravitaci, "kulatost" Země nebo existenci elektronu.
So the Nationalists and the Socialists have the same policy on Brexit. They should get together and form a...
Daniel Kvasnička ml. avatar 28.7.2006 10:39 Daniel Kvasnička ml. | skóre: 52 | blog: The Joys and Sorrows of Being an IT Freak | Ostrava
Rozbalit Rozbalit vše Re: Evoluce přirodním výběrem je nezpochybnitelný fakt
Nemam problem smirit se s existenci evoluce a jejim fungovanim, mam problem smirit se s tim, ze to vsechno nejak samo nahodou vzniklo bez pricineni vyssi inteligence.

Druha vec, se kterou se neminim smirit, je chovani evolucnich vedcu, kteri odmitaji slyset namitky kreacionistu jen proto, ze jsou kreacioniste - i kdyz ta ci ona namitka zrovna nema evolucionismus potopit, ale pomohla by treba veci vyjasnit.
FSF: “screw you for not wanting the stuff we produce”, People: “screw you for not producing the stuff we want."
kyknos avatar 28.7.2006 10:48 kyknos | skóre: 18 | blog: Quid novi? | Ranša Rosa
Rozbalit Rozbalit vše Re: Evoluce přirodním výběrem je nezpochybnitelný fakt
1) Jaké námitky kreacioniostů? Dokážeš vymyslet nějakou vědecky relevantní námitku? Tedy takovou, která není založena na víře?

2) Právě inteligence je produktem evoluce, ne naopak. Pokud by vše začala vyšší inteligence, kde by se vzala ona? Jak se dokážeš smířit s tím, že se tu nějak vzala vyšší inteligence, když se nejsi schopen smířit s tím, že se tu (nějak, náhodnou evolucí) vzala ta inteligence naše? To nemá logiku a není to racionální úvaha. Může být jen předmětem víry. Ale o té nemá smysl diskutovat. A vědce oprávněně nezajímá.
So the Nationalists and the Socialists have the same policy on Brexit. They should get together and form a...
Daniel Kvasnička ml. avatar 28.7.2006 11:56 Daniel Kvasnička ml. | skóre: 52 | blog: The Joys and Sorrows of Being an IT Freak | Ostrava
Rozbalit Rozbalit vše Re: Evoluce přirodním výběrem je nezpochybnitelný fakt
1) Jaké námitky kreacioniostů? Dokážeš vymyslet nějakou vědecky relevantní námitku? Tedy takovou, která není založena na víře?
Nepochopils me. Jde mi o poukazovani na chyby v evolucni teorii a zamerne kryte skutecnosti (a prosimte nesnaz se me tu ptat jake - je to nesmysl, nejsem tvuj Google ani vedec, to, ze evolucni teorie ma diry, se vi. To, ze ja ti ted tady nejake nevysypu neznamena, ze nejsou, to je snad logicke.)

Je jedno, kdo na to poukazuje, ale proste to delaji nejcasteji kreacioniste. A neni snad v zajmu vedy se dostat maximalne dopredu ve snaze vysvetlit tyhle veci? Mel bys byt rad, ze nekdo neda pokoj a pta se na to, proc se opomiji tohle, proc tohle nekdo nevysvetli. Ja to povazuju za produktivni, stejne jako povazuju za produktivni, kdyz napr. uzivatel neda pokoj vyvojari, protoze v software neco nefunguje jak ma.
2) Právě inteligence je produktem evoluce, ne naopak. Pokud by vše začala vyšší inteligence, kde by se vzala ona? Jak se dokážeš smířit s tím, že se tu nějak vzala vyšší inteligence, když se nejsi schopen smířit s tím, že se tu (nějak, náhodnou evolucí) vzala ta inteligence naše? To nemá logiku a není to racionální úvaha. Může být jen předmětem víry. Ale o té nemá smysl diskutovat. A vědce oprávněně nezajímá.
Ty veris, ze nic takoveho na pocatku nebylo, ja verim, ze ano. Podstatou Boha je, ze je. Clovek, ktery se pta na vznik Boha, Boha nepochopil. Smej se mi, urazej me, delej co chces. Ted ti tu nic nevymyslim, ale filozofickych pojednani obhajujicich nutnost existence Boha pri pohledu na dnesni i minuly svet je dost. Treba si uz nejake cetl a stejne nesouhlasis. Neberu ti to.
FSF: “screw you for not wanting the stuff we produce”, People: “screw you for not producing the stuff we want."
28.7.2006 12:05 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce přirodním výběrem je nezpochybnitelný fakt
..protože to, co lze o Bohu poznat, je jim zřejmé; Bůh jim to zjevil. Jeho věčnou moc a božství, ačkoli jsou neviditelné, lze totiž od stvoření světa jasně vidět, když lidé přemýšlejí o jeho díle, takže jsou bez výmluvy.
(Bible)
kyknos avatar 28.7.2006 12:20 kyknos | skóre: 18 | blog: Quid novi? | Ranša Rosa
Rozbalit Rozbalit vše Re: Evoluce přirodním výběrem je nezpochybnitelný fakt
Stejně tak lze vidět kteréhokoliv z jiných nekompatibilních bohů či bohyň. Stejně tak lze vidět jakýkoliv blud, když má člověk fantazii (či ochotu přijímat cizí fantazie) a touhu to udělat.
So the Nationalists and the Socialists have the same policy on Brexit. They should get together and form a...
28.7.2006 12:09 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce přirodním výběrem je nezpochybnitelný fakt

Ad 1. Žádná vědecká teorie si neusurpuje patent na pravdu, to je doména náboženství. Vědecký přístup při popisu světa* spočívá právě v tom, že a priori počítá s tím, že jeho model se může ukázat chybným, protože se ukáže, že jeho závěry odporují reálným měřením či pozorováním. V takovém případě je třeba model buď upravit, aby realitě (v mezích možností) odpovídal, nebo třeba i úplně zahodit a přijít s novým. To není žádné uhýbání nebo výmluvy, jak to označuje pan Kábrt, to je standardní proces vědeckého poznávání. V historii se to stalo mockrát a ještě mockrát se to stane. Proto dnešní evoluční biologie vypadá úplně jinak než za Darwina (kdyby nic jiného, tak už proto, že Darwin neměl tušení o genetice), bohužel to někteří její odpůrci dosud nezaregistrovali.

Proto mi vadí náboženské výklady, protože ty jsou od základu vystavěny tak, aby žádný rozpor s realitou vzniknout nemohl, protože neposkytnou žádné verifikovatelné závěry. Když už se to přežene, nějaká předpověď se omylem vydá, nepotvrdí se a někdo vám v tom vymáchá nos, tak se řekne, že to byla chyba interpretace nebo že to bylo myšleno jen obrazně. To je prostě úplně jiný model uvažování, který mně je proti srsti. Ale možná přesně proto se vám naopak nelíbí ten vědecký.


* - napsal bych vědecký světový názor, kdyby tento termín nebyl tak zprofanovaný jeho zneužíváním socialistickým režimem

28.7.2006 12:12 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce přirodním výběrem je nezpochybnitelný fakt
Ono, kdyby se v nějaké vědecké práci na téma evoluce objevil jediný odstavec podobný těm v díle pana Kábrta, pak vyjdou kreacionisté do ulic a budou radostí pálit školy a výzkumáky.
Copak toho není dost?
28.7.2006 12:15 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce přirodním výběrem je nezpochybnitelný fakt

Hlavně by takovou práci žádný časopis, který chce být brán aspoň trochu vážně, nikdy ani nepřijal k oponentuře, natož aby ji vydal…

28.7.2006 12:18 VícNežNic | skóre: 42 | blog: Spáleniště | Ne dost daleko
Rozbalit Rozbalit vše Re: Evoluce přirodním výběrem je nezpochybnitelný fakt
Škoda, já už si dělal naděje, že mi taky něco vezmou, když může Kábrt být věděc :-)
Copak toho není dost?
kyknos avatar 28.7.2006 12:14 kyknos | skóre: 18 | blog: Quid novi? | Ranša Rosa
Rozbalit Rozbalit vše Re: Evoluce přirodním výběrem je nezpochybnitelný fakt
Nepochopils me. Jde mi o poukazovani na chyby v evolucni teorii a zamerne kryte skutecnosti (a prosimte nesnaz se me tu ptat jake - je to nesmysl, nejsem tvuj Google ani vedec, to, ze evolucni teorie ma diry, se vi. To, ze ja ti ted tady nejake nevysypu neznamena, ze nejsou, to je snad logicke.)
Promiň ale já jsem studoval biologii, navštěvoval jsem rok přednášky zaměření na evoluční teorie, načetol jsme spousty literatury,a le žádné díry, které by evoluční teorii popíraly jsme nikdy neviděl. Ovšem pokud bereš za evoluční teorii staré dílo pana darwina, pak jistě. Jeho teorie se jako každá vědecká teorie vyvíjí a zdokonaluje. Dokonce je plná nejasností. Vědci se o spoustu detailů přou. Ale ten základní princip, který Darwin přinesl, je dnes stále vědecky nezpochybnitelný.

Ty veris, ze nic takoveho na pocatku nebylo, ja verim, ze ano. Podstatou Boha je, ze je. Clovek, ktery se pta na vznik Boha, Boha nepochopil.
Věř si co chceš. Ale nemotej to do vědy a vědeckého poznání světa. Víra tam nepatří a nemá s tím nic společného. Její argumenty jsou pro vědce nezajímavé. Nejsou to totiž vědecké hypotézy. A nevědecké hypotézy vědu nezajímají.
So the Nationalists and the Socialists have the same policy on Brexit. They should get together and form a...
28.7.2006 12:19 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce přirodním výběrem je nezpochybnitelný fakt
Ale ten základní princip, který Darwin přinesl, je dnes stále vědecky nezpochybnitelný.

Zde je ovšem slovo nezpochybnitelný třeba chápat ve smyslu, že dnes nejsou známy žádné skutečnosti, které by ho zpochybňovaly, ne že ho z principu nelze zpochybnit. To se samozřejmě teoreticky může stát hned zítra - jenže věda s tím počítá; proto se tomu také říká teorie.

kyknos avatar 28.7.2006 12:22 kyknos | skóre: 18 | blog: Quid novi? | Ranša Rosa
Rozbalit Rozbalit vše Re: Evoluce přirodním výběrem je nezpochybnitelný fakt
Jistě, proto jsem také napsal dnes :) Ovšem vzhledem k nezměrnému úsilí a nespočetným pokusům tuto myšlenku vyvrátit odhaduji, že tato teorie s námi bude velmi dlouho nebo ještě déle :)
So the Nationalists and the Socialists have the same policy on Brexit. They should get together and form a...
28.7.2006 12:34 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce přirodním výběrem je nezpochybnitelný fakt
Promiň ale já jsem studoval biologii..
já také... dokonce ještě za komunistů, kdy si na evoluční teorii dávali obvzláště záležet. (musím uznat, že propracované to opravdu je...)
načetol jsme spousty literatury,a le žádné díry, které by evoluční teorii popíraly jsme nikdy neviděl.
Možná jsi je vidět nechtěl. (nerejpu - myslím to vážně)
kyknos avatar 28.7.2006 12:37 kyknos | skóre: 18 | blog: Quid novi? | Ranša Rosa
Rozbalit Rozbalit vše Re: Evoluce přirodním výběrem je nezpochybnitelný fakt
Ale chtěl. Kdybych totiž nějaké našel, byl bych slavný vědec a možná bych nakonec dostal i Nobelovku. A pokud jsi je viděl ty, ukaž mi je prosím :)
So the Nationalists and the Socialists have the same policy on Brexit. They should get together and form a...
28.7.2006 12:50 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce přirodním výběrem je nezpochybnitelný fakt
No, kdyby to bylo tak černobílé, asi by neexistovaly dva tábory.. Myslím, že tady různých příkladů a argumentů bylo uvedeno dost a já se nechci točit pořád dokola.
kyknos avatar 28.7.2006 12:54 kyknos | skóre: 18 | blog: Quid novi? | Ranša Rosa
Rozbalit Rozbalit vše Re: Evoluce přirodním výběrem je nezpochybnitelný fakt
Ano existují dva tábory. Jeden vědecký a druhý nevědecký - pánbíčkářský. Nevědecké argumenty mě (stejně jako ostatní vědce a komisi rozhodující o udělování Nobelových cen za přírodní vědy) nezajímají. Pořád čekám na alespoň jeden vědecký argument zpochybňující základní principy moderní evoluční teorie.
So the Nationalists and the Socialists have the same policy on Brexit. They should get together and form a...
28.7.2006 18:40 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce přirodním výběrem je nezpochybnitelný fakt

Ahoj. Rozhodl jsem se napsat ještě jeden (tento) příspěvek k celé věci a tím bych to ze sevé strany rád uzavřel.

Já jsem se také učil evoluční teorii i to, že náboženství je opium lidu a je pro staré babky. Když jsem poprvé četl knihu Jablko sváru, vedlo mne to k tomu, že jsem začal o věcech přemýšlet.

Je mi úplně jedno, jestli je tamten nebo onen argument překonaný a podobně. Důležité bylo, že jsem byl ochotný zkusit se podívat na věci z druhé strany. To řada lidí není ochotná udělat.

O mnoho let později jsem zažil Toho, kterému nevěříš a kterému se zde veřejně vysmíváš v akci. Lidé okolo mne byli viditelně uzdravováni z různých i z nevyléčitelných nemocí. Žádnou z těchto věcí není možné "vědecky" vysvětlit. Když člověk něco takového zažije, zažije takovouto věc, obvykle ho to mělo změnit, ale jsou i takoví, pro které ani toto není dkůaz.
Žádnou z těchto věcí není možné "vědecky" vysvětlit.

Ale víš, co je na tom pikantní?
Někteří lidé měli měli lékařsky zdokumentovyný svůj zdravotní stav. Předtím i potom. A když přišli ke svému lékaři - odmítal uznat, že jsou zdraví.

Když mu ukázali vyšetření, kde to podle hodnot, rentgenu atd. bylo nepopiratelné - stejně to odmítal uznat(!). A když už to nemohl argumentačně obhájit pod tíhou faktů - víš co nakonec řekl? Že se při přechozích diagnózách mýlili(!). Bylo úplně jedno, že měl v rukou kvanta vyšetření z minulosti, razítka a já nevím co ještě. Prostě to nezapadalo do jeho přesvědčení, tak to prostě nebylo.

Existuje mnoho věcí, které vysvětlit rozumem prostě nejde.
Ale lidé, kteří to nechtějí uznat, to prostě neuznají a důkazy pro ně nejsou.

- Filmové záznamy jsou pro ně falzifikáty.
- Řekneš - li - já jsem tam byl a viděl jsem to na vlastní oči - řeknou: "něco se Ti zdálo".
- Řekneš - li - já jsem to prožil, žeknou, že jsi blázen.
- i kdyby viděli před sebou mrtvého vstát z mrtvých - řeknou, že mrtvý vlastně nebyl...

Lidé stojící na této straně nikdy žádný argument slyšet nebudou. Což je velká škoda.

Původně jsem toto nechtěl psát, ale po nějakém čase přemýšlení jsem se rozhodl proto, že to udělám. Toto je část mého osobního svědectví. Víc už k tomu ale dodávat nechci. Díky za čas (i za angažovanost v letní flameware ;-) a měj se dobře.)

Luděk
28.7.2006 18:49 LuděkS | skóre: 30 | blog: publish | Liberec
Rozbalit Rozbalit vše Re: Evoluce přirodním výběrem je nezpochybnitelný fakt
No koukám, že se mi to stylisticky pěkně pokroutilo. Nějak mi tu nefunguje myš, takže se mi tam některé věci vložily dvakrát (grr) Podotýkám, že to nebyl záměr a ani to není tím, že bych vypil příliš mnoho Mountain Swill
Marek Bernát avatar 28.7.2006 22:06 Marek Bernát | skóre: 17 | blog: Arcadia
Rozbalit Rozbalit vše Re: Evoluce přirodním výběrem je nezpochybnitelný fakt

- Filmové záznamy jsou pro ně falzifikáty.
- Řekneš - li - já jsem tam byl a viděl jsem to na vlastní oči - řeknou: "něco se Ti zdálo".
- Řekneš - li - já jsem to prožil, žeknou, že jsi blázen.
- i kdyby viděli před sebou mrtvého vstát z mrtvých - řeknou, že mrtvý vlastně nebyl...

Pravda je vždy taká, akú sa ju rozhodneme vnímať. Ale určité druhy pravdy sú také, ktoré sa rozpadajú pod váhou vlastných argumentov. Ak teda máme ešte chuť pochybovať. Prípady, ktoré ste uviedli, sú príliš všeobecné a v konkrétnom prípade môže byť pravda (teda tá, ktorá obstojí relatívne nezaujatú argumentáciu) na oboch stranách.
physics.stackexchange.com -- Q&A stránky o fyzike v štýle StackOverflow.
28.7.2006 13:13 Filip Jirsák | skóre: 67 | blog: Fa & Bi
Rozbalit Rozbalit vše Re: Evoluce přirodním výběrem je nezpochybnitelný fakt
Jde mi o poukazovani na chyby v evolucni teorii a zamerne kryte skutecnosti … to, ze evolucni teorie ma diry, se vi.
Každá vědecká teorie se upřesňuje a přepracovává tak, aby byla v souladu se skutečností, kterou pozorujeme. Ale to co padlo v této diskuzi a zmíněných dokumentech, to není poukazování na chyby v evoluční teorii. To je saha tam ty chyby vyrábět a pak na jejich základě teorii zesměšnit. Ve zmíněných dokumentech jsem nenašel opravdu na ani jedno poukázání na skutečnou chybu v evoluční teorii. Pokud někdo takhle k nějaké teorii přistupuje, prokazuje tím jejímu ověřování medvědí službu, protože nikdo nebude mít chuť hledat v té teorii skutečné chyby, protože bude muset nejprve dokazovat, že on není stejný blázen jak P.K.&spol.
28.7.2006 10:59 Filip Jirsák | skóre: 67 | blog: Fa & Bi
Rozbalit Rozbalit vše Re: Evoluce přirodním výběrem je nezpochybnitelný fakt
Druha vec, se kterou se neminim smirit, je chovani evolucnich vedcu, kteri odmitaji slyset namitky kreacionistu jen proto, ze jsou kreacioniste - i kdyz ta ci ona namitka zrovna nema evolucionismus potopit, ale pomohla by treba veci vyjasnit.
A kde jsou ty námitky? Ve dvou zde zmíněncýh dokumentech jsem viděl námitky trojího druhu – autor/ka vymyslí nějakou teorii, kterou v textu podstrčí evoluční teorii, a následně tuto svou teorii rozcupuje. Druhý druh námitek je ten, že proti evoluční teorii postaví falešná "fakta". A třetí je ten, že autor/ka o něčem napíše, že se mu/jí to prostě nezdá, nelíbí nebo tomu nevěří. Ani jeden z těchto tří druhů námitek nemůže nic objasnit.

Bohužel to nevypadá, že by sklaní kreacionisté dokázali přijít s nějakými zajímavými námitkami…
28.7.2006 11:32 Michal Vyskočil | skóre: 60 | blog: miblog | Praha
Rozbalit Rozbalit vše Re: Evoluce přirodním výběrem je nezpochybnitelný fakt
Čtvrtým případem je nepochopení pravděpodobnosti a nulová představivost ohledně obrovských časových úseků. Zpochybňovat děje, které se odehrávaly milióny let tak, že se je za přibližně 200 let nepodařilo vysvětlit, či napodobit, je další oblíbená taktika.
When your hammer is C++, everything begins to look like a thumb.
kyknos avatar 28.7.2006 11:45 kyknos | skóre: 18 | blog: Quid novi? | Ranša Rosa
Rozbalit Rozbalit vše Re: Evoluce přirodním výběrem je nezpochybnitelný fakt
Věřící různých směrů obvykle (nevím proč) neuvěřitelně lpí na myšlence. že je vše předem dáno a deterministické. Proto se nemohou s chaotickou a na náhodě bytostně postavenou evolucí smířit.
So the Nationalists and the Socialists have the same policy on Brexit. They should get together and form a...
28.7.2006 11:58 Michal Kubeček | skóre: 71 | Luštěnice
Rozbalit Rozbalit vše Re: Evoluce přirodním výběrem je nezpochybnitelný fakt
Paradoxem je, že pak přírodním vědám vyčítají přílišné lpění na determinismu a ostrém vnímání světa, přestože přírodní vědy už pěkných pár desítel let takto svět nevidí…
Marek Bernát avatar 28.7.2006 22:15 Marek Bernát | skóre: 17 | blog: Arcadia
Rozbalit Rozbalit vše Re: Evoluce přirodním výběrem je nezpochybnitelný fakt
God does not play dice with the universe .-)
physics.stackexchange.com -- Q&A stránky o fyzike v štýle StackOverflow.
kyknos avatar 29.7.2006 01:59 kyknos | skóre: 18 | blog: Quid novi? | Ranša Rosa
Rozbalit Rozbalit vše Re: Evoluce přirodním výběrem je nezpochybnitelný fakt
Přečti si mou patičku :)
So the Nationalists and the Socialists have the same policy on Brexit. They should get together and form a...
Marek Bernát avatar 29.7.2006 11:39 Marek Bernát | skóre: 17 | blog: Arcadia
Rozbalit Rozbalit vše Re: Evoluce přirodním výběrem je nezpochybnitelný fakt
Všimol som si ho, ale nerozumel som ani slovo. Až teraz mi docvaklo :-)
physics.stackexchange.com -- Q&A stránky o fyzike v štýle StackOverflow.
Marek Bernát avatar 28.7.2006 22:09 Marek Bernát | skóre: 17 | blog: Arcadia
Rozbalit Rozbalit vše Re: Evoluce přirodním výběrem je nezpochybnitelný fakt
Nebuďme zaujatí. Ja môžem za seba povedať, že mám tiež nulovú predstavivosť, čo sa týka dlhých časových úsekov a veľkých vzdialeností. Také veci sú proste nepredstaviteľné.
physics.stackexchange.com -- Q&A stránky o fyzike v štýle StackOverflow.

Založit nové vláknoNahoru

ISSN 1214-1267   www.czech-server.cz
© 1999-2015 Nitemedia s. r. o. Všechna práva vyhrazena.